1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rjkz [21]
3 years ago
14

A scientist hypothesizes that the lack of chinook salmon is negatively affecting the orca population. Would this hypothesis need

to be tested by another scientist in order to become a theory? Why or why not?
Biology
1 answer:
german3 years ago
6 0

Answer: Yes

Even if there is an abundance of fish in the oceans, and that even if the general rule is that big things eat smaller things, it is not true with the <span>orca population (whales).  Whales depend on chinook salmon for survival, and truly, the hypothesis that the lack of chinook salmon negatively affecting the orca population is true.</span>

<span>However, for a hypothesis to become lifted to the ranks of a theory once it passes a series of tests. Other scientists may claim its correctness, other may oppose to it.  So there is a need to </span><span>differentiate between the hypothesis on checking and competing hypotheses.</span>

You might be interested in
3. The major cause of water pollution by industries involves
Serga [27]

Answer:

when foreign harmful materials like chemicals, waste matter, or contaminated substances are directly or indirectly discharged into water bodies.

Explanation:

3 0
3 years ago
Read 2 more answers
Is this true or false, "As the control centers of the cell, the mitochondria also have a significant limiting effect on cell siz
IrinaVladis [17]
I believe it's false. The nucleus is the control center of the cell. The mitochondria is commonly known as the cell's powerhouse.
3 0
3 years ago
How do dolphins communticate
Ber [7]

Answer:

chirps, squawks, squeals and whistles

Explanation:

7 0
3 years ago
Identify three things that can increase the rate of mutation
Alenkasestr [34]

Some chemicals increase the mutation rate, physical agents such as radiation also increase the mutation rate. There are viruses that are mutagens as well. Also, the number of mutations that an organism produce can also be phenotypically plastic.

Hope this helps. (This is the definition my bio teacher gave me.)

5 0
3 years ago
How should “free water” have been administered to the patient?
Firdavs [7]

Answer: Via ice chips or water, although not appropriate for all patients.

Explanation:

Patient is allowed to drink water btwn meals (beginning a minimum of 30 mins after meals); oral care must be done prior to consuming water; patient should be upright and use appropriate swallowing strategies.

3 0
3 years ago
Other questions:
  • A skeleton forming outside the animal’s body is a(n)
    13·1 answer
  • What is the conversion factor from km. to ft.? If Joe traveled 12 kilometers, how many feet did he travel?
    13·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • You have recently discovered a new gene, have it cloned, and suspect this gene is a proto-oncogene. What is a proto-oncogene and
    8·1 answer
  • According to the picture above. What is the possible scientific questions being investigated
    9·1 answer
  • Any help would be extra help thank you
    14·1 answer
  • The cells in the nervous system that handle information processing are called? specialty cells. blood cells. synapses. neurons.
    6·1 answer
  • silver oxide coatings with high silver-ion elution rates and characterization of bactericidal activity
    11·1 answer
  • What causes the characteristic thrashing motion of nematodes?
    7·1 answer
  • An immunoglobulin (Ig) molecule, of any class, with regions symbolized as C or V, H or L , has a light chain made up of _______.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!