1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksklad [387]
3 years ago
8

What volume is occupied by 3.760 g of oxygen gas at a pressure of 88.4

Chemistry
1 answer:
Lorico [155]3 years ago
4 0

Answer:

3.2 L

Explanation:

Given data:

Mass of oxygen = 3.760 g

Pressure of gas = 88.4 Kpa (88.4×1000 = 88400 Nm⁻²)

Temperature = 19°C (19+273.15 = 292.15 K)

R = 8.314 Nm K⁻¹ mol⁻¹

Volume occupied = ?

Solution:

Number of moles of oxygen:

Number of moles = mass/ molar mass

Number of moles = 3.760 g/ 32 g/mol

Number of moles = 0.12 mol

The given problem will be solve by using general gas equation,

PV = nRT

P= Pressure

V = volume

n = number of moles

R = general gas constant

T = temperature in kelvin

V = nRT/P

V = 0.12 mol ×  8.314 Nm K⁻¹ mol⁻¹ × 292.15 K /88400 Nm⁻²

V = 291.472 Nm /88400 Nm⁻²

V = 0.0032 m³

m³ to L:

V = 0.0032×1000 = 3.2 L

You might be interested in
Calculate the molarity of each of the following solutions. Use the periodic table if necessary.
-Dominant- [34]

Answer: 2.8

Explanation: just took the quiz

8 0
3 years ago
Read 2 more answers
Can someone solve this for me I'm confused.
Artemon [7]

Answer:

310.53 g of Cu.

Explanation:

The balanced equation for the reaction is given below:

CuSO₄ + Zn —> ZnSO₄ + Cu

Next, we shall determine the mass of CuSO₄ that reacted and the mass Cu produced from the balanced equation. This can be obtained as follow:

Molar mass of CuSO₄ = 63.5 + 32 + (16×4)

= 63.5 + 32 + 64

= 159.5 g/mol

Mass of CuSO₄ from the balanced equation = 1 × 159.5 = 159.5 g

Molar mass of Cu = 63.5 g/mol

Mass of Cu from the balanced equation = 1 × 63.5 = 63.5 g

Summary:

From the balanced equation above,

159.5 g of CuSO₄ reacted to produce 63.5 g of Cu.

Finally, we shall determine the mass of Cu produced by the reaction of 780 g of CuSO₄. This can be obtained as follow:

From the balanced equation above,

159.5 g of CuSO₄ reacted to produce 63.5 g of Cu.

Therefore, 780 g of CuSO₄ will react to produce = (780 × 63.5)/159.5 = 310.53 g of Cu.

Thus, 310.53 g of Cu were obtained from the reaction.

6 0
3 years ago
A student places a beaker on a hot plate. To the beaker, he adds a clear liquid and a white powder. The mixture instantly begins
Elenna [48]
True, because if it wasn't a chemical reaction it would have proceeded to stay the same. but it begins to bubble.
sorry if this isn't the best answer I'm trying my best.
7 0
4 years ago
Read 2 more answers
Which one is you fav one
serious [3.7K]

Answer:

the 3rd one

Explanation:

8 0
3 years ago
Read 2 more answers
What kinds of energy does the Sun provide earth
AysviL [449]
 I am positive it is solar energy
 

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following compounds exhibit hydrogen bonding?
    14·1 answer
  • Which of the following requires an oxidizing agent?
    5·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The chemical hazard label indicates the class of hazard. It uses three major color-coded categories: Health (yellow), Flammabili
    9·1 answer
  • Which scientist proposed the model of an atom as a solid sphere?
    10·1 answer
  • A 3.00-L flask is filled with gaseous ammonia, NH3. The gas pressure measured at 27.0 ∘C is 2.55 atm . Assuming ideal gas behavi
    6·1 answer
  • The equation, 2 H2(g) + O2(g) Imported Asset 2 H2O(l), represents an equation for a standard formation reaction.
    11·2 answers
  • What compound is YCI3
    6·1 answer
  • You have 30.4 g of O2 gas in a container with twice the volume as one with CO2 gas. The pressure and temperature of both contain
    7·1 answer
  • **PLEASE HELP** If you were presented with a preserved brain specimen, but weren’t told whether it was from a human or a sheep,
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!