1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetlana [45]
2 years ago
13

Variations of homologous genes that result in differences in structure and function are

Biology
2 answers:
damaskus [11]2 years ago
4 0
Alleles. Alleles are the "same" genes, but provide a variation of the intended function. 
Step2247 [10]2 years ago
4 0

Answer: Alleles

Explanation:

The variation in the homologous genes that result in different structure and function is known as allele. They represent the different forms of genes one is dominant and one is recessive.

The expression of characters by both the genes are different. Example: If T represents tallness then t represents dwarfness.

The homologous pair TT represents tallness and the other allele on the same gene is tt which shows dwarfness.

You might be interested in
__________ is the neurotransmitter used to carry a message from a motor neuron to a skeletal muscle fiber.
KatRina [158]
Acetylcholine (ACh)

Acetylcholine is an organic chemical that functions in the brain and body of many types of animals as a neurotransmitter.
6 0
2 years ago
The production of egg and sperm cells follows a certain sequence of events.
Maru [420]
The production of egg and sperm cells follows a certain sequence of events.

The correct order of those events are:
MEIOSIS, CELL DIFFERENTIATION, MATURE GAMETES.

Meiosis is defined as the process wherein a single cell is divided twice to produce four cells that contains half the original amount of genetic information.

Cell differentiation is defined as the process wherein the less specialized cell becomes a more specialized cell. The haploid cells are the end result of meiosis. They must undergo cell differentiation before they can become mature gametes.
3 0
2 years ago
Is it true or false of the finding of evidence of liquid water on Mars is important because water is essential for life?
ki77a [65]
Water is essential to life because it creates us humans, plants, animals, etc. So, if we find water on Mars it would be important because water is essential to life, meaning we would know that there would be some kind of life on Mars because water makes up anything. 
7 0
2 years ago
Milankovitch cycles ________. select one:
Vitek1552 [10]
<span>The Milankovitch theory explains the long term climate change and the </span>
Milankovitch cycles describe the effects of changes as a result of climate change. There are three Milankovitch cycles:about Earth's Eccentricity (the shape of the Earth's orbit around the Sun), Axial tilt (the inclination of the Earth's axis in relation to its plane of orbit around the Sun) and precession (the Earth's slow wobble as it spins on axis).
According to this, Milankovitch's cycles <span>are changes in earth's rotation and orbit around the sun that may trigger climate variation. (B).</span>


6 0
2 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
2 years ago
Other questions:
  • Whats the answer please??
    8·1 answer
  • What property of a hormone would allow it to pass unassisted through a plasma membrane?
    13·1 answer
  • Which ball will have thw greatest acceleration
    13·1 answer
  • Put in order from first to last
    7·1 answer
  • Muscular strength is assessed by measuring what?
    5·1 answer
  • Which of the following produces the greatest amount of carbon dioxide?
    11·1 answer
  • Which of the following is NOT an example of an ecological service provided by forests?
    6·2 answers
  • What is the difference between
    5·1 answer
  • What’s the correct choice?<br><br><br> bio
    14·2 answers
  • Why out off 500 mouses 237 are black and 263 are white
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!