1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dima020 [189]
3 years ago
15

Migration is always temporary true or false

Biology
2 answers:
yawa3891 [41]3 years ago
4 0
Migratoin is not always temporary so the anser is false
borishaifa [10]3 years ago
4 0
The correct answer is false
You might be interested in
What are human trachea epithelium specialized to do
disa [49]

Answer:

To moisten and to protect the airway from stuff like unknown pathogens and infection

Explanation:

The Trachea also known as the windpipe has tons of 'little hairs' called cilia in the epithelium that protect the throat. When someone smokes or breathes in gases it is destroyed and exposes the trachea. But thats another story. :)

6 0
3 years ago
What is an indirect measure of the amount of energy released from food?​ a. ​The increase in heat given off when the food is bur
lana [24]

Answer:

e. ​Quantity of oxygen consumed when the food is burned

Explanation:

The quantity of oxygen that's used up is known as an indirect measure for amount of energy that's released from the food you burn and Bomb calorimeters may be used to estimate the amount of energy in food.

5 0
3 years ago
What process did the substance experience?
Mama L [17]

Answer:

(Show a picture/reference of the question)

Easy Explanation:

Condensation - Water vapor turning into liquid.

Evaporation - Liquid to water vapor.

Freezing - Water turning into ice.

Melting - Ice turning into water.

7 0
3 years ago
Did your observations provide evidence to support any of the claims
Lyrx [107]

Answer:

jhvjgk gh ggjjg

Explanation:

4 0
3 years ago
Why are genetic variation and selective breeding are advantages of sexual reproduction?
soldier1979 [14.2K]
The evolution of sexual reproduction is a great puzzle in modern evolutionary biology. Many groups of eukaryotic organisms, especially most animals and plants, reproduce sexually. The evolution of sex between two organisms of the same species contains two related but different themes: its origin and its maintenance. However, since hypotheses for the origin of sex are difficult to test experimentally, most of the current work has focused on the maintenance of sexual reproduction. Biologists, including W. D. Hamilton, Alexei Kondrashov, and George C. Williams, have proposed various explanations for how sexual reproduction is maintained in a large set of different living things.
5 0
3 years ago
Other questions:
  • Which was not a result of the 1898 discovery of the four blood types
    7·1 answer
  • How do isotopes of the same element differ from each other?
    14·1 answer
  • Which of the following is the best name for SO3?
    14·2 answers
  • Which of the following is not necessarily true of metapopulations?
    6·1 answer
  • According to learning theorists:a. Behavior arises from moral beliefs.b. Moral behavior arises through reason.c. Moral beliefs a
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Describe how the properties of water relate to biology
    14·1 answer
  • Reef-building coral are marine animals with single-celled algae living in their tissues. The coral provide protection for the al
    6·1 answer
  • for patients with prediabetes, what strategies does the diabetes prevention program show are effective in reducing the risk of p
    7·1 answer
  • Plssss help answer must be two lines
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!