1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katyanochek1 [597]
3 years ago
12

explain how scientists can know if the wolves are having a negative or positive impact at yellowstone.

Biology
1 answer:
poizon [28]3 years ago
4 0

Answer:

Explanation: when animals that wolves eat start to disappear around the area

You might be interested in
Identify which two of Koch's postulates would most likely not be fulfilled when trying to link a human virus to a particular dis
hammer [34]

Answer:

 A) & B)

Explanation:

A) There are certain viruses that are present in both healthy and disease people.

Example: Polio virus is found in many human but it causes disesease in only 1% of human.

B) Viruses require host machinery for replication so they may not replicate in pure culture.

The postulate C is also violated, the virus may not produce disease in non-human experimental host because of inappropriate animal or vaccinated animal etc. Others exception includes, the same disease may be caused by various organisms and different organisms can also cause the same disease.

3 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
What are the limitations of the dissecting microscope?
Gennadij [26K]
Stereomicroscopes is that they have a much lower magnification limit than other microscopes, such as the compound microscope, for instance. The stereomicroscope can magnify an image 100-150 times, while normal compound microscopes can magnify an image 1000-1500 times. This can be a disadvantage of stereomicroscopes, because not as much detail of the image is seen.
3 0
3 years ago
Compare and contrast the processes of photosynthesis and cellular respiration
Ainat [17]
In photosynthesis o2 is released while in cellular respiration o2 is taken.
Photosynthesis occur in the presence of sunlight while cellular respiration has no boundations
Both require o2.
Both leads to the formation of new substance.
6 0
3 years ago
The flow chart below indicates the hierarchical levels of the Linnaean classification system.
Radda [10]

Answer:

Species

Explanation:

The lower down they go, the more characteristics they have in common.

Animals have the least amount of shared characteristics in Domain, but the most in species.

7 0
3 years ago
Other questions:
  • Mr. Morales is teaching a lesson on classification. He says that spiders are classified as a different group than insects becaus
    9·2 answers
  • Which best summarizes the concept of natural selection?
    7·2 answers
  • Which of the following events triggers the subsequent steps of excitation-contraction coupling?
    12·2 answers
  • Cual crees que es la ventaja de la organización social en los animales
    11·1 answer
  • Which measurement do geologists use to find the absolute age of once-living things?
    7·2 answers
  • Which body system gets glucose into your blood​
    11·1 answer
  • Find the ph after adding 10ml in the titration<br>of 25 mL of 0.3M HA with 0.3 M NaOH of 0.3M NaOH​
    9·1 answer
  • How do sea anemones benefit from their relationship with clownfish?
    14·1 answer
  • Brainly Est question
    5·2 answers
  • What is the first step of the scientific method?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!