Amino acids. Every protein is a long chain of amino acids.
Answer:
An autosomal dominant gene is one that occurs on an autosomal (non-sex determining) chromosome. As it is dominant, the phenotype it gives will be expressed even if the gene is heterozygous.
The chances of an autosomal dominant disorder being inherited are 50% if one parent is heterozygous (NL) for the mutant gene and the other is homozygous for the normal (NN), or 'wild-type', gene. This is because the offspring will always inherit a normal gene from the parent carrying the wild-type genes, and will have a 50% chance of inheriting the mutant gene from the other parent. If the mutant gene is inherited, the offspring will be heterozygous for the mutant gene, and will suffer from the disorder. If the parent with the disorder is homozygous for the gene, the offspring produced from mating with an unaffected parent will always have the disorder.
Explanation:
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Solution A has 10 times more hydrogen ions than solution B.. The correct option is B.
<h3>What is a pH?</h3>
pH is the potential of hydrogen ions, or measure of hydrogen ion concentration.
It is generally used to determine the acidity and basicity of the solution based on pH scale.
The pH scale is logarithmic, which means that each pH unit contains ten times the number of hydrogen ions as the unit above it. So solution A has 10 times more hydrogen ions than solution B.
Thus, the correct option is B.
For more details regarding pH, visit:
brainly.com/question/491373
#SPJ1