1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alex41 [277]
3 years ago
14

A tight rope walker who does not want to change his position will want the forces acting on him to be Blank Space __________. Qu

estion 5 options: large small balanced unbalanced
Biology
2 answers:
Katarina [22]3 years ago
8 0

The correct answer for fill in the blanks is Balanced.

Tight rope walker does not want to change his position to make sure that   the force acting on him is balanced. A slight change in the position of the  rope walker will make the rope move and this movement will result in the unbalance the force exerted on the walker. So, to make the force balance he will not change his position.

aliina [53]3 years ago
6 0
Your answer would be balanced. Hope this helps YOU!
You might be interested in
Which of the following statements would correctly complete the flowchart?
hjlf
The answer would be A
8 0
3 years ago
The crystals that form in slowly cooling magma are generally ____.
inna [77]
The answer is Large. 
6 0
3 years ago
Read 2 more answers
What molecule is produced as a byproduct when two or more monosaccharides are combined together?
alexdok [17]

Answer; Disaccharide is form when two monosaccharides undergo a dehydration reaction ( or a condensation reaction).

7 0
3 years ago
When wind slows down, it deposits sediment. What feature is created by the deposition of loosely packed, mineral-rich soil?
tamaranim1 [39]

The feature that is created by deposition of the loosely packed and mineral-rich soil is Loess.

Loess is a loosely packed soil deposition due to blown wind of sediment rocks. The geography of loess is in between soil and clay. It is finer in texture than soil but has the coarse structure than the clay. This loess contains certain clay portions in order to hold the soil particles properly.

It can be mostly seen in Great Plains of North America, northern china, and other places around the world.

4 0
3 years ago
Read 2 more answers
PLZZ
fredd [130]
The answer is B to your question
5 0
3 years ago
Read 2 more answers
Other questions:
  • BRAINLIESTTTT ASAP!!!!!!
    8·1 answer
  • How would a taxonomist decide to place a sea turtle into a paticular family
    7·1 answer
  • If a rock sample has a mass of 1.17 g and a volume of 0.33 cm3, what type of rock is it?
    13·2 answers
  • Cycles of four chemicals essential to life on earth: water, carbon, nitrogen and phosphorus. be sure to use appropriate key term
    9·1 answer
  • We can control malaria by controlling mosquito
    15·2 answers
  • How much weight can you lose fasting for 24 hours?
    15·1 answer
  • Explain how does cell structure relates to cell function?
    7·1 answer
  • The space between the dendrites of one nerve cell and the axon of the?
    8·1 answer
  • The nitrogenous base adenine can pair with, what?
    5·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!