1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jek_recluse [69]
3 years ago
12

Which of the following would be considered a source of error in an experiment?

Biology
1 answer:
Colt1911 [192]3 years ago
4 0
<span>D. Temperature readings are made late in the day, when everyone is tired and eager to go home.

</span><span>Errors are what makes your measurement invalid and unreliable. There are two types of error which is called the systematic error and the random error. Each error has different sources. Words that were mentioned –invalid and unreliable are very important key aspects to determine that your measure is truly accurate and consistent. Some would recommend using the mean method, doing three trials in measuring and getting their mean, in response to this problem.</span>
You might be interested in
Compare the physical and chemical properties of a compound to those of the elements of which it is composed
zepelin [54]

Answer:

Compound is a pure substance which is made from atoms of different elements combined together in a fixed ratio by mass.It can be decomposed into simpler constituents using chemical reactions. Example: water H_2O

2H_2O(l)\rightarrow 2H_2(g+O_2(g)

Physical property is defined as the property of a substance which becomes evident during physical changes. Water is liquid at room temperature whereas hydrogen and oxygen are gases at room temperature.

Chemical property is defined as the property of a substance which becomes evident during chemical changes. Water reacts with metals to form bases, hydrogen reacts with metals to form hydrides and oxygen reacts with metals to form oxides.

6 0
4 years ago
Which of the above is the macromolecule that contains starch and glycogen? Carbohydrates II. Lipids III. Proteins IV. Nucleic Ac
Eduardwww [97]

Carbohydrates

I'm not sure but....Please correct me if I'm wrong!! :)

6 0
4 years ago
What percentage of the global population lives in the United States?
bekas [8.4K]

Answer: 4.25%

Explanation:

As at Friday, May 28, 2021, the population of the United States of America is about 332,754,370. The population of the world is about 7,868,904,000.

Therefore, the percentage of the global population lives in the United States is about 4.25% that's 332,754,370/7,868,904,000 × 100%.

3 0
3 years ago
Describe how the role of phloem would be affected if the leaves start to die off. Tell what phloem does in a plant.
Zarrin [17]

Describe how phloem is affected if the leaves start to die off. (3 points) The phloem is effected by the deprivation of water from the disease of the tree, as a result the metabolism of the plant will shift down ward causing the phloem to decrease due to the dying of the leaves.

7 0
3 years ago
_________8. Which of the following is probably evolved first?
Burka [1]

Answer:

I think D) Glycolysis

Explanation:

<em>Glycolysis</em> is the <em><u>first pathway</u></em> used in the breakdown of glucose to extract energy. It takes place in the cytoplasm of both prokaryotic and eukaryotic cells. It was probably one of the earliest metabolic pathways to evolve since it is used by nearly all of the organisms on earth.

4 0
3 years ago
Other questions:
  • Robert and Tonia are on a date. Tonia is smiling and expressing herself in ways that indicates that she likes Robert. On the oth
    9·2 answers
  • SOMEONE PLEASE ANSWERRR!!!
    13·1 answer
  • What are extensions of the plasma membrane that serve primarily to increase a cell's surface area called?
    13·1 answer
  • 2. You water three sunflower plants with salt water. Each plant receives a different concentration of salt solutions. A fourth p
    11·1 answer
  • 1. Synthesize Information How do you explain to the horse owner why this foal was
    12·1 answer
  • The kingdom Animalia includes all of these except jellyfish. sponges. amoebas. roundworms.
    15·2 answers
  • What is the relationship between cells and tissue?​
    10·1 answer
  • What are the correct genotype percentages?
    5·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • The variety of organisms within an ecosystem is characteristic of which type of diversity?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!