1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
just olya [345]
2 years ago
14

What additional levels of organization are in multicellular organisms

Biology
1 answer:
babymother [125]2 years ago
6 0

Take a look at the pictures below.  The black and white one shows the "basic" levels, which the colorful one goes a bit deeper.

I hope that helps! :)

You might be interested in
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Are seals secondary consumers? if so do they eat phytoplankton?
daser333 [38]

Answer:

Yes, they are secondary consumers, who sometimes eat phytoplankton

Explanation:

4 0
2 years ago
How are those 3 characteristics different for rocks?
Nady [450]

Answer:

rocks can be smooth ridged or sharp

Explanation:

there rocks and they can form differently

5 0
2 years ago
Which enzyme helps in the digestion of carbohydrates?
Papessa [141]

Answer:

its D

Explanation:

i did it

8 0
3 years ago
WHAT IS TRUE ABOUT SCIENTIFIC LAWS
Tju [1.3M]
1. Scientific laws are observations of similar events that have been observed repeatedly.

2. A scientific law states something is going to happen

3. A scientific law is mostly based on a well-supported hypothesis.
6 0
3 years ago
Other questions:
  • A blood test to monitor anticoagulation therapy for patients taking heparin is
    12·1 answer
  • Compare structure to function of organs in a variety of organisms
    10·1 answer
  • What type of bacteria can be found in pairs, chains, squares of four, cubes of eight, or grape like clusters?
    5·1 answer
  • Answer the following:Meiosis / Mitosis:1. ____One division consisting of prophase, metaphase, anaphase, and telophase. 2. ____Pr
    8·1 answer
  • What are 2 conditions to enhance infant memory?
    6·1 answer
  • PLEAE HELP!!!!!!!!!!!!!!!!!!!
    8·2 answers
  • Why would joint damage be associated with rapid growth and low testosterone levels?
    6·2 answers
  • Base your answer to the question on the information below and on your knowledge of biology.
    6·1 answer
  • Pea plants can have alleles for being tall or for being short. A pea plant has one allele for being tall, and one allele for bei
    8·1 answer
  • If a scientist is conducting an experiment about obesity and asks a group of people to stop eating saturated fat, that group of
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!