Parasympathetic nervous
Parasympathetic nervous
system is known to be one of the two divisions of the autonomic nervous system
and it is responsible for the stimulation of rest and digest activities that
usually occur when the body is at rest after eating which includes salivation,
urination, sexual arousal and digestion.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Answer:
Explanation:
a nuclioud b plasmid c capsule
"The differences in pre-mRNA splicing that results in an altered pattern of exon inclusion" is most likely to have contributed to this phenomenon.
<u>Option: C</u>
<u>Explanation:</u>
The expression of the eukaryotic gene requires several stages and can be regulated by several of them. Different genes are controlled at different locations and it is not unusual for a gene to be controlled at multiple steps, especially a significant or powerful one.
- In accessibility of Chromatin the chromatin structure includes DNA and can be regulated by its assembling proteins. More free or 'relaxed' chromatin allows a gene more transcriptible.
- For many genes transcription is a key regulatory point. Its factor protein sets bind to unique DNA sequences within or near to a gene and encourage or suppress its transcription into an RNA.
- It is possible to control the splicing, capping, and attaching a poly-A tail to an RNA molecule, and thus exit the nucleus. Specific mRNAs might be produced by alternative splicing from the same pre-mRNA.
