1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nana76 [90]
3 years ago
8

Why do leaves appear green?

Biology
2 answers:
s2008m [1.1K]3 years ago
6 0

<u>Answer:</u>

The correct answer option is B. Green wavelengths are the least used in photosynthesis.

<u>Explanation:</u>

Plants have a pigment in them called as chlorophyll. This chlorophyll is able to absorb only certain wavelengths of the light within the light spectrum.

From that visible light spectrum, chlorophyll is only able to absorb light of red and blue wavelength. The green light is not absorbed by the by chlorophyll as it is reflected back.

Therefore, this reflection of green light makes the leaves to appear green.

MAVERICK [17]3 years ago
5 0
I believe the answer is B
You might be interested in
Which three organs produce enzymes that digest proteins ?
11111nata11111 [884]

1. Amylase, produced in the mouth. It helps break down large starch molecules into smaller sugar molecules.

2. Pepsin, produced in the stomach.

3. Trypsin, produced in the pancreas.

I'm probably wrong. Sorry.

4 0
3 years ago
List four "beliefs" in which evolutionary scientists place their faith when supporting the theory of evolution. Use complete sen
VashaNatasha [74]

Answer:  Answers below.

Explanation: One aspect in which evolutionists place their faith in is the geological column. If you examine a chart of it, you will notice a trend. As you go deeper into the geological column, the fossils found there get more and more "simple". On the surface of the geological column, scientists have found more complex life forms. This trend suggests that organisms evolved over time, and the geological column represents this trend in chronological order. However, this data could be used against evolution as well. Therefore, it is inconclusive. If you believe the sedimentary rock formed so rapidly due to the biblical flood, this is evidence against evolution. If you believe rocks formed according to the observations of Charles Lyell, then this could be evidence for evolution. It all depends on how one interprets the data.

Another aspect in which evolutionists place their faith is something they call "intermediate links" Intermediate links are supposed to indicate a transitional form between two different creatures to show that they evolved. For example, evolutionists state that the creature Archaeopterynx is the transitional form between reptiles and birds. Another example of a transitional form found is the Australopithecus afarensis, which is supposed to be the transitional form between apes and humans due to similar bone structures and that this creature was bipedal like us humans.

Another belief evolutionists have to support the theory of evolution is the science of structural homology. Structural Homology is a science that studies similar structures in different organisms. For example, if you examined the forearms of a bat, bird, porpoise, and human, you would find that they have similar forearm structures, They all have a radius, humerus, ulna, carpals, metacarpals and phalanges. This indicates that all these creatures evolved from a common ancestor due to their strikingly similar structures.

Another aspect in which evolutionists place their faith is in the science of molecular biology. You see, all organisms contain a common protein called cytochrome C. Cytochrome c performs the same basic function in every organism. It is possible to calculate the percentage difference between the cytochrome c in each organism. Evolutionists have created a table that shows the percentage difference between a few different species of organisms. What they found appeared to indicate an evolutionary trend. However, more research shows that this data is highly flawed. If you calculate the percentage difference of this protein between a horse, pigeon, tuna, silkworm moth, wheat, the yeast and compared it to a bacterium ( the "simplest" life form) you would find that all these organisms are almost the same percent different from each other, indicating individual species rather than evolving from a common ancestor. All of these assumptions stated above can be evidence for or against evolution. It all is determined by how someone interprets these facts. I hope this helped you! Good luck :)

3 0
4 years ago
which enzyme is responsible for transcribing a gene on a DNA strand into an RNA molecule during transcription ​
lana [24]
MRNA does the transcription I believe
5 0
3 years ago
PLZ HELP ASAP!!!!!! What are the organisms still alive that display some of the earliest vertebrate evolutionary characteristics
qaws [65]
Hag Fish and Lamprey
Vertebrates are the organism which posses a vertibral column(aka the spine or back bone structure), while the earliest had a head they lacked a spine and jaw, these jawless vertebrae lived 500-600 million years ago. they are the ancestors of bony fish which in time became amphibians and other groups of animals
7 0
2 years ago
What are the structures of a villi?
daser333 [38]
What the other person said!
3 0
3 years ago
Read 2 more answers
Other questions:
  • Monomers are joined together by _______ to form polymers. polymers are broken down into monomers by _______.
    11·1 answer
  • What's the definition of science
    5·1 answer
  • Describe how insulation works and the role it plays in keeping our homes at a comfortable temperature.
    14·1 answer
  • HURRY ! Which statement is best supported by the data in the graph?
    9·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What hormone(s) do the Testes produce?
    10·1 answer
  • Which variable is likely to undergo the largest change in value resulting from a mutation that introduces a new allele into a po
    5·1 answer
  • Three cells that each has a diploid number of 32 go through mitosis. How
    15·1 answer
  • *
    6·1 answer
  • What does a plant use for all its processes?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!