1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WITCHER [35]
3 years ago
15

What are the units of a pyramid of energy?

Biology
1 answer:
oee [108]3 years ago
4 0

<span>The units of a pyramid of energy </span>are expressed in units of energy per area per time (e.g. kJ m^–2 year^–1) which is grams per meter2<span> per year or calories per meter</span>2<span> per year</span><span> so letter A will be the answer.</span>

You might be interested in
What type of Volcano is built Almost entirely from ejected lava fragments ?
miss Akunina [59]
I think it’s a cinder cone volcano
5 0
3 years ago
Species that are multi-celled, have nuclei, and photosynthesize can be found only in
Nezavi [6.7K]

Answer:

yooo I have the same question

Explanation:

its animalia and plantae

4 0
3 years ago
Read 2 more answers
Deficiency of vitamin b can lead to
Stolb23 [73]
Vitamin B12 deficiencies can lead to megaloblastic anemia, a condition where the bone marrow produces large abnormally shaped red blood cells that do not function properly. Dementia, paranoia, depression, and behavioral changes can result from a vitamin B12 deficiency. Neurological damage sometimes cannot be reversed
8 0
2 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
How does leaf structure best represent the relationship between structure and function? It indicates the maximum height an organ
vova2212 [387]

Answer:

The correct answer is - *It relates directly to the characteristics of the plant's environment*

Explanation:

The relationship between structure and function can be represented by the leaf structure as the structure of a particular plant leaf gives an idea about the characteristics of the environment it is habituated.

In the dry area or deserted area, leaves are modified into spikes to save water in order to lower transpiration, number of waxy coating, number of chlorophyll, and other modifications that give an idea about the environment and light intensity, and other characteristics.

6 0
4 years ago
Other questions:
  • Which structure in the female reproductive system is comparable to the external reproductive organs in males?
    9·2 answers
  • There is a division of labor among the cells of multicellular organisms. Please select the best answer from the choices provided
    5·1 answer
  • In what way do you think the location of the foramen magnum relates to the movement of each
    10·1 answer
  • Why is dna replication like an assembly line?
    13·2 answers
  • 15. Which is not a problem associated with the increased use of nuclear energy?
    10·1 answer
  • How do hormone disruptors affect the endocrine system?
    8·1 answer
  • Mr. r married a healthy woman in his home country of italy and had three children, a boy with beta-thalassemia minor and two hea
    8·1 answer
  • Dose anyone know plz
    14·2 answers
  • Earthworms help farmers. Many farmers add them to their farmland because they help form rich soil to grow crops in.
    7·1 answer
  • 10. Exchange of gases takes place<br><br>​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!