I think it’s a cinder cone volcano
Answer:
yooo I have the same question
Explanation:
its animalia and plantae
Vitamin B12 deficiencies can lead to megaloblastic anemia, a condition where the bone marrow produces large abnormally shaped red blood cells that do not function properly. Dementia, paranoia, depression, and behavioral changes can result from a vitamin B12 deficiency. Neurological damage sometimes cannot be reversed
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
The correct answer is - *It relates directly to the characteristics of the plant's environment*
Explanation:
The relationship between structure and function can be represented by the leaf structure as the structure of a particular plant leaf gives an idea about the characteristics of the environment it is habituated.
In the dry area or deserted area, leaves are modified into spikes to save water in order to lower transpiration, number of waxy coating, number of chlorophyll, and other modifications that give an idea about the environment and light intensity, and other characteristics.