1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Troyanec [42]
3 years ago
15

He active ingredient(s) in tobacco that is addictive, colorless, and a highly volatile alkaloid is __________.

Biology
1 answer:
irina [24]3 years ago
8 0
The answer would be nicotine.


Nicotine is an addictive substance. The type of nicotine that is found particularly in tobacco is nicotiana tabacum. It comes from the nightshade family of plants. Other forms of nicotine can also be found in tomatoes, potatoes, green peppers, and eggplants. 
You might be interested in
What is the boundary around an animal cell
ollegr [7]

Answer:

plasma membrane/ cell membrane

6 0
3 years ago
What might stimulate the cephalic phase of gastric secretion?
kiruha [24]

Complete Question:

Which of the following might stimulate the cephalic phase of gastric secretion?

A. stomach distention

B. the production of saliva

C. the thought of food

D. the production and secretion of gastrin.

Answer:

C. the thought of food

Explanation:

Gastric secretion usually occurs in three different phases, namely;

- Cephalic

- Gastric

- Intestinal

The thought of food usually stimulate the cephalic phase of gastric secretion in organisms. The presence of lipids or low pH inhibits Gastric secretion during the intestinal phase.

7 0
3 years ago
Interneurons receiving input from sensory neurons are located in the ________.
alisha [4.7K]

Answer:

Dorsal horn

Explanation:

The sensory neurons cell bodies are present in dorsal horns. The front side of spinal cord consist of two arms of it. The ventral horn is the centrally located grey matter with motor neurons cell bodies.

The dorsal horns are located at each spinal cord levels that are four in number. The sensory nuclei is present in dorsal horns that perceive somatosensory information. The information is then transferred to midbrain and diencephalon. Thus, Interneurons receiving input from sensory neurons are located in the dorsal horn.

4 0
3 years ago
Which the following statements typifies tropical rain forests? A. They are usually composed of at least ten distinct layers, or
Novosadov [1.4K]

        The right answer here is option C. They occur in areas with ancient, mineral-poor soil.

         An example of that is Amazonia in Brazil, it's one of the biggest forests on earth, and at the same time, we know its soil is poor, but at the same time it has some special materials that can be found there, such as niobium. This forest is, too, rainy almost all the time, and this many trees maintain the temperature of the whole earth stabilized. These kinds of forests can grow in this soil because of the burlap, that's organic materials from its own trees. It's consumed by them, and through this way, it survives and extends its size when humans don't use its resources too much.

6 0
3 years ago
This organ produces a chemical called saliva that begins to break down food in the mouth.
puteri [66]

Answer: salivary glands

Explanation: i just remember from 4th grade health class

7 0
2 years ago
Other questions:
  • Why is gravity important?
    5·2 answers
  • Which of the following correctly describes the difference between dominant and recessive traits?
    13·1 answer
  • Short answer question
    11·1 answer
  • If a pair of organisms are capable of producing fertile offspring in nature, they must belong to the same A) class B) kingdom C)
    7·2 answers
  • Renewable energy sources account for the majority of energy production.<br><br> t<br> f
    13·2 answers
  • NEED ANSWER ASAP
    11·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What is Cellular Respiration?
    14·2 answers
  • 4. Why does cell division take place in single celled organisms?
    5·1 answer
  • Please help me on this its due now​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!