Answer:
How many countries are the original members
Answer:
The tail of the sperm, the flagellum
Explanation:
We find cilia in the human body. They coat the epithelial cells of the upper respiratory tract and play a role in keeping dust particles, smog, and potentially harmful microorganisms from entering the lungs.
Their movements enable the movement of mucus or other substances across the surface of various epithelial cells. The cilia also cover parts of the male and female reproductive tract.
Flagella are found in sperm, whose tail represents the flagellum in its structure. The body wall of the sponge, among others, contains cells with whips that create and maintain the flow of water through the body.
<span>(C) container for the fertilized egg
Hope this helps!</span>
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
<span>4
Nicotine is as harmful as smoking even much time. As the effects of Snuff are stronger and reactions faster in the blood than even for conventional cigarette smokers. The harmful side effects of smoking cigarette would be even more faster for snuff sniffers than cigarette smoker because of the level of nicotine</span>