1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhannawk [14.2K]
3 years ago
12

Need help I don’t understand

Biology
1 answer:
lisabon 2012 [21]3 years ago
5 0

its asking for you to check the box if the item is preset in the cell hint: eukaryotic cells have a nucleus so you would say yes in the box. but since prokaryotic cells don't have a nucleus say no in the box

You might be interested in
What is the subcutaneous layer that separates the integument from the deep fascia around other organs?
QveST [7]

Answer:

Answer is hypodermis .

Explanation:

The hypodermis which is also known as the subcutaneous tissue layer, is found lying beneath the dermis and act as a passageway or channel through which blood vessels and nerves passed. It is made up of fat and connective tissues.

It acts as an insulator, this, help in keeping the body temperature stable.

3 0
4 years ago
the oldest species of the genus homo is: group of answer choices homo habilis homo erectus homo ergaster homo antecessor
inysia [295]

Homo erectus is the oldest species of the genus homo

  • Homo erectus is An extinct species of hominid that lived throughout most of the Pleistocene geological epoch.
  • The first hypothesis of origin is that Homo erectus rose from the Australopithecina in East Africa sometime during-or perhaps even before-the Early Pleistocene geological epoch, which itself dates to 2.58 million years ago.
  • The earliest hominin genera is (Australopithecus)
  • The earliest Homo-species is  (such as Homo habilis or Homo ergaster).
  • Homo erectus" means Upright man"
  • Primate group most closely related to hominids is Apes
  • The two major groups of anthropoids are  Monkeys and apes

To know more about Homo erectus     visit : brainly.com/question/177662

#SPJ4

4 0
2 years ago
Large amounts of sewage cause a lot of algae to grow, which lowers the concentration of carbon dioxide in the water. *
natima [27]
Cbnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

3 0
4 years ago
Which of the following describes what can happen to an enzyme as temperature rises
Gala2k [10]
That would be C.

Rise in temperature can cause enzymes(proteins) to denature, change their shape and thus their function.
4 0
3 years ago
Which of the following choices is an example of agricultural biotechnology?
lbvjy [14]
B - cross breeding cows

Biotechnology utilizes biological systems, living organisms or parts of this to develop or create different products
3 0
3 years ago
Read 2 more answers
Other questions:
  • 1 point
    9·2 answers
  • Why do scientists study earth as a system
    13·1 answer
  • Which of the following is not responsible for driving deep ocean circulation?
    13·2 answers
  • 5. The diagram shows a position on Earth at
    12·1 answer
  • PLEASE HELP!!
    15·1 answer
  • What is the difference between homeostasis and equilibrium
    12·1 answer
  • You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATT
    15·1 answer
  • How do we know North America was once connected to the Highlands in Scotland?
    12·2 answers
  • what would happen if photosynthesis and cell respiration didn't perform their roles in the carbon cycle? What would be a possibl
    12·1 answer
  • Which adaptations originated in some fishes and enabled vertebrates to thrive on land?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!