1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-BARSIC- [3]
3 years ago
9

Someone who is heterozygous for recessive allele that cause a disorder

Biology
1 answer:
IRISSAK [1]3 years ago
3 0

Someone who is heterozygous for a recessive allele that codes for a disorder of some sort will not express the disorder in his or her genotype, but would be considered a carrier of the allele, and could pass it on to his or her offspring if the other parent is either heterozygous or homozygous for the recessive allele.

You might be interested in
Oxygen-rich blood is transported from the lungs by the _____.
alukav5142 [94]

Answer: FROM THE PULMONARY VEIN

Explanation: oxygen poor blood from the right ventricle into the lungs, where the oxygen enters  the bloodstream. The pulmonary veins bring oxygen rich blood to the left atrium.

4 0
3 years ago
Read 2 more answers
Which has very high population density
Hoochie [10]

Answer:

a

Explanation:

8 0
2 years ago
D) 6. In a marine ecosystem, small fish must be able to
Natalka [10]
Yes some fishes have long tails that can be a threat which can cause fights.
4 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
What is the relationship between structure and function in the selected muscle?
Vlad [161]
Smooth muscle I think
7 0
3 years ago
Other questions:
  • What plant requirement is the Cusichaca Andina group working to preserve
    7·1 answer
  • The carbon in coal, oil, and natural gas come from
    12·2 answers
  • The _____ method can help resolve problems logically.
    5·2 answers
  • Which factor affects the amount of runoff that occurs in an area?
    12·2 answers
  • Reaction rates
    11·1 answer
  • The human body has many cells that are deep inside the body. For this reason, the
    15·2 answers
  • Most biologists consider the most intelligent invertebrate animal to be a
    12·1 answer
  • What are the functions of each layer of the atmosphere?
    14·1 answer
  • Im confused its more science but yah oof
    12·2 answers
  • List the six nitrogen bases that would pair with the following sequence of bases in a strand of DNA: T C G A C A
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!