1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-BARSIC- [3]
3 years ago
8

Which predator is typically found in Central Africa

Biology
1 answer:
koban [17]3 years ago
7 0
Most probably a king cobra snake, which originates from yes Central Africa, especially in Kenya.
You might be interested in
Electron transport chain location is
stepan [7]

it is located the inner mitochondrial membrane

3 0
3 years ago
What does it mean to complement a substrate?
bulgar [2K]

Answer:

A number of complement proteins are proteases that are themselves ... factor D has no other substrate than factor B when bound to C3b. This means that factor

Explanation:

5 0
2 years ago
What happens during synapsis?
ozzi

Answer:

C

Explanation:

8 0
3 years ago
Which of the following aspects of society is the least affected by limiting factors?
krok68 [10]
Behavior is the least affected by the limiting factors.

Behavior can remain constant throughout the conditions but when necessary, adaptations can occur due to the limiting factors that constrict a certain action.

<span>Adaptation is the unique trait that animals and plants have in order to survive through the evolution of time. </span>
4 0
2 years ago
Which rocks cool the slowest.
Sladkaya [172]
Dioride, gabbro, granite - they're intrusice ingeour rocks.
8 0
3 years ago
Other questions:
  • How does over-hunting cause a species’ population to decrease? A. Most of the surviving individuals move away. B. Too few indivi
    6·2 answers
  • You notice the line of mercury in your barometer is all the way to the top—30 inches. Is this high or low pressure? What kind of
    6·2 answers
  • In multicellular organisms, cells are organized into tissues, tissues into organs, organs into organ systems, and systems
    14·1 answer
  • What is the plant tissue responsible for limiting water loss
    12·2 answers
  • Which of these is a possible risk associated with stem cell therapy? A) The host’s body could reject the transplanted stem cells
    14·2 answers
  • A team of scientists is working to formulate a drug that can treat children who are diagnosed with gigantism. Which effect shoul
    13·2 answers
  • A gene encoding one of the proteins involved in the DNA replication has been inactivated by a mutatiion in a cell. In the absenc
    7·1 answer
  • All of the plants and animals living in the same area make up a ?
    7·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Teeheeteeheeteeheeteeheeteeheeteehee teehee teehee teehee teehee teehee
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!