1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
3 years ago
6

Turn the following statement into a

Biology
2 answers:
ki77a [65]3 years ago
6 0

Answer:

If Sally is hungry then she eats a snack.

Explanation:

This is basically like cause and effect. If this certain thing happens, then this will happen.

julsineya [31]3 years ago
4 0

Answer:

The correct answer will be- " If sally feels hungry, then she eats a snack".

Explanation:

A scientific hypothesis is a predicted statement proposed which explains the natural event to a limited extent. A hypothesis is based on the previous research work so is considered as the educated guess.

A hypothesis is designed in a way that it can be proved or disproved through the experiment so it should contain the variables which could be tested.  

In the given question the proposed hypothesis will be-" If sally feels hungry, then she eats a snack" which shows the variables which can be tested.

You might be interested in
4 properties of water are
expeople1 [14]

Answer:

Cohesion and Adhesion.

Temperature Moderation.

Low Density of Ice.

Ability to Dissolve Other Substances.

Explanation:

8 0
3 years ago
Read 2 more answers
Which of the following describes an in vivo experiment? A .observations are made in a buffered solution. B. Observations are mad
Shkiper50 [21]
C. Observations are made in a living mouse

An in vivo experiment consists on conducting the study in a whole living organism, in this case, a mouse
6 0
3 years ago
Read 2 more answers
Urgghhhhhhhhhhhhhhhhhhhhh
SVEN [57.7K]
I think  A) but not really a lot of info 
8 0
3 years ago
Read 2 more answers
Which molecules do not normally cross the nuclear membrane?
Crazy boy [7]

Answer:

DNA do not normally cross the nuclear membrane.

Explanation:

DNA (Deoxyribonucleic acid) is present in the nucleus which contains the genetic information of an organism. Nucleus is necessary for whole the process of cell division and initiation. During cell division DNA plays a most important role carrying of genetic information of old cell to the newly synthesized cells, which only occurs during cell division.

All processes like replication and transcription needs enzymes which are normally found in the nucleus. So, for the protection of DNA keeping DNA within the nucleus and do not cross the nuclear membrane. If DNA is floating in the cytoplasm than DNA can not be transcribed its information into RNA and this process is known as transcription process (DNA into RNA).

8 0
2 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 10 million years. Examine th
jarptica [38.1K]
Since this is a relatively short string of DNA, we can count the number of mutations between the two strings. Firstly, Species A has thymine as the 2nd nucleotide, while Species B has adenine.2. Second, the 7th nucleotide of A has cytosine while B has thymine. Finally, the 16th nucleotide (3rd from the last) of A has adenine while B has thymine.
Since there are 3 point mutations, we multiply this by the frequency of 10 million years per mutation to get a time of 30 million years.
3 0
2 years ago
Other questions:
  • The tar in cigarette smoke contains chemicals that contribute to the development of
    15·1 answer
  • Similar to a hurricane only weather ?
    8·1 answer
  • Reproductive mother cell
    13·2 answers
  • Please arrange these in the correct order
    5·1 answer
  • Are hypothesis's based on laws or theories
    12·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which organism is capable of reproduction through asexual mitosis?
    13·1 answer
  • Aerobic exercise increases the body's consumption of which of these?
    5·1 answer
  • Which of the following is an advantage of sexual reproduction over asexual reproduction?
    15·1 answer
  • What happens to phosphorus when animals die?​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!