1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiks02 [169]
3 years ago
15

If a bean is placed into a solution and the moisture is pulled from the bean (making it shrivel

Biology
1 answer:
Kitty [74]3 years ago
6 0
Hypertonic because isotonic is a normal solution and hypotonic means it goes into the cell
You might be interested in
How many protons are in the nucleus of an aluminum atom​
WITCHER [35]

Answer:

13 protons

Explanation:

Aluminum has an atomic number of 13, therefore it has 13 protons.

3 0
4 years ago
Drag each tile to the correct location on the table,
Tom [10]

Answer:

Mechanical Isolation

A snail with a flat disc-like shell

will not be able to mate with a

snail having a conical shell.

The reproductive organs of

male bush babies do not

match with the reproductive

organs of females of other

bush baby species

Behavioral Isolation

The mating call of a cricket is not

recognized by a cricket of other

species.

The signals sent by a male firefly

are not recognized by the female

firefly of other species.

Explanation:

Mechanical isolation occurs in the scenario where two organisms are willing to mate but cannot do so due to the physical challenges. As in the case of snail a flat disk and a conical disk snail are willing to mate but physical barriers restrict them in doing so.

The same case is with the male and female bush babies where the difference in reproductive organs does not allow them to mate.  

Behavioral isolation represents a scenario where two organisms are unaware of mating rituals, season, pattern or signals of each other and hence cannot mate.  

For example – male and female cricket do not recognize the mating call of each other. Likewise male and female firefly is also not able to understand each other’s mating signal.

3 0
3 years ago
Read 2 more answers
Aldosterone is synthesized from cholesterol. <br> a. True<br> b. False
patriot [66]

Answer:

The correct answer is A. Effectively, aldosterone is synthesized from cholesterol.

Explanation:

Aldosterone is a steroid hormone from the mineralocorticoid family, synthesized in the glomerular area of the adrenal cortex of the adrenal gland. It acts in the conservation of sodium, in the secretion of potassium and in the increase of blood pressure. Its secretion is decreased in Addison's disease and increased in Conn's syndrome. Aldosterone, as well as all steroid hormones, is synthesized from cholesterol.

5 0
3 years ago
Justify the statement “Structure of a cell is adapted to its function”, by giving examples of 2 plant and 2 animal cells that ar
3241004551 [841]

Answer:

plant cells, palisade mesophyll cell, spongy mesophyll cell

animals- mitochondria, ribosomes

4 0
2 years ago
How does the respiratory system and the digestive system work together?
Len [333]
They work together to give the cells the ingredients they need to produce energy.
5 0
4 years ago
Other questions:
  • In this section, please include the if/then statements you developed during your lab activity. These statements reflect your pre
    11·2 answers
  • Differing amounts of solar radiation across earths latitude affects the ocean ____?
    11·1 answer
  • How does a vaccination help to prevent a disease? it reduces the severity of symptoms to a disease. it generates a population of
    7·1 answer
  • How do vectors contribute to the spread of disease?
    5·1 answer
  • Which of the following provides the most conclusive evidence that organisms of two different species share a common ancestor?
    10·2 answers
  • Which best describes the order of the technology used to transmit a sound through the radio? microphone → transmitter → micropho
    12·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which of the following observations BEST demonstrates water’s special property of cohesion?
    7·1 answer
  • Membrane proteins are among the most important proteins biologically because they allow the cells to communicate with their
    13·1 answer
  • These structures contract to close a bivalve and keep its soft body safe.
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!