1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
2 years ago
15

Justify the statement “Structure of a cell is adapted to its function”, by giving examples of 2 plant and 2 animal cells that ar

e specialized cells. Also list the advantages for cells adapting to its function.
Biology
1 answer:
3241004551 [841]2 years ago
4 0

Answer:

plant cells, palisade mesophyll cell, spongy mesophyll cell

animals- mitochondria, ribosomes

You might be interested in
Help! Will give brainlist
irinina [24]
Answer: B

Explanation: So air, like most other substances, expands when heated and contracts when cooled. Radiation cooling occurs when air near the ground is cooled by the Earth's surface losing heat by radiation.
6 0
3 years ago
In pea plants, purple flowers are dominant over white flowers. The phenotype ratio of purple to white flowers in a population of
noname [10]
1. It’s 4 purple flowers to 1 white flower
6 0
3 years ago
What is the difference between ATCGAT and CCAGTA genes
Akimi4 [234]

Answer:

the pattern

Explanation:

5 0
3 years ago
What would be the expected result if a competitive, nonhydrolyzable analog of ATP were applied to the cytoplasmic side of a plas
Yakvenalex [24]

Answer:

The cell interior would experience higher than normal Na+ concentrations and lower than normal K+ concentrations.

Explanation:

The Na/⁺K⁺ pump is an ATPase pump which is responsible for maintaining low Na⁺ and high K⁺ concentrations within the cytoplasm while maintaining high Na⁺ and low K⁺ concentrations in the extracellular fluid.

Since these two ions are moved against their concentration gradient, ATP hydrolysis is required to provide the energy for this process. This is done by moving in two K⁺ ions  inside while moving three Na⁺ ions outside the cell for every molecule of ATP hydrolysed to ADP and Pi.

If a competitive non-hydrolyzable analog of ATP is applied on the cytoplasmic side of a plasma membrane that contained a large concentration of the Na/⁺K⁺ pump, it will act by inhibiting the action of the Na/⁺K⁺ pump. This will result in an accumulation of Na⁺ ions inside the cell and lower than normal K⁺ ions concentration.

6 0
3 years ago
Which of the following is NOT true about male condoms?
Phantasy [73]
A) is false as condoms aren't designed to be used twice and it increases the risk of your partner getting pregnant


5 0
4 years ago
Other questions:
  • Changes in the genetic make-up are normally ______
    11·2 answers
  • Sexual reproduction relies on two sex cells uniting in fertilization to form a single cell know as a(n) _______.
    8·1 answer
  • SO, I had a dream i was at a family gathering at my grandma's house. And there was a fat bald guy named Derrek. This derek guy t
    6·2 answers
  • This statement describes the Maya's opinion of animals, based on the Popol Vuh.
    13·2 answers
  • Conduction of nerve impulse​
    9·1 answer
  • Bacterial enzymes that cut DNA are also called restrictive exonucleotides. True or False?
    5·2 answers
  • (NO LINKS)
    6·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Recall what you know about cell biology to complete the statements. DNA is located in the of the cell. DNA contains segments cal
    14·1 answer
  • Modeling Photosynthesis
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!