The number of chromosomes in a female
scorpion’s egg cells have half as many chromosomes as compared in her body
cells. Chromosome is a single long molecule of DNA wound around proteins called
histones. It is
made up of DNA wrapped around proteins.
16 neutrons are present in the most abundant isotope.
Explanation:
Phosphorus has 18 isotopes. The most common isotope has mass number (no. of protons 15+ no. of neutrons 16=) 31 .
One reason is because the short days and long nights prevent the earth from warming up, another reason could be because the sun's rays in winter are more spread out thus minimizing the amount of energy
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.