1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Assoli18 [71]
3 years ago
8

(HELP)

Biology
2 answers:
Sergeu [11.5K]3 years ago
6 0
The answer is a. the abiotic components of an ecosystem
max2010maxim [7]3 years ago
4 0
A the abiotic components of an ecosystem
You might be interested in
Why can genes be considered derived characters?
aev [14]

A derived character refers to a particular character that is shared by members of a particular population. Genes are considered to be derived characters because THEY ARE TRANSFER FROM GENERATION TO GENERATION FROM PARENTS TO THEIR OFFSPRING. Genes are derived from the DNA molecule of the parents and these are passed to their offspring during the process of cell division in reproduction.


3 0
3 years ago
Read 2 more answers
In mice, brown eyes (B) are dominant over blue (b). A homozygous brown-eyed male mouse mates with a blue-eyed female and they ha
bazaltina [42]
Parents: Homozygous brown-eyed (M) - B B
                                    blued-eye (F)     -  b b    [since blue (b) is recessive then                                                                                      and brown (B) is dominant then
                                                                           in order for the blue gene to
                                                                           show the you need double                                                                                              recessive or the brown
                                                                           gene absent 

Offspring:
So based on the Punnett cross then you realize that all the possible of spring carry the genotype B b and as such the phenotype brown eyes
                                                                          

8 0
3 years ago
Genetics is defined as ________.
Alecsey [184]

The correct answer is B. The science of inherited traits

Explanation:

Genetics refers to the field in biology that focuses on studying genes which are the basic units of heredity and therefore the ones that determine inherited traits. Indeed genetic study the way traits are passed through reproduction and also the way genes change over time or express which is closely connected to evolution. Additionally, genetics have been widely studied beginning by the works of Mendel during the 19th century and nowadays the knowledge about genes including the behavior, function, and structure of them is broad. According to this, genetics is defined as the science of inherited traits.

5 0
4 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
A: ¿Qué necesitaban del continente africano para seguir operando las 24 horas)qué necesitaban el continente
Flura [38]

Answer:

english

Explanation:

please,

7 0
3 years ago
Other questions:
  • In two or more complete sentences describe how a dam placed in a river can act as both a constructive and destructive force.
    14·2 answers
  • PLEASE HELP ASAP!!!!!!!! BEST ANSWER GETS BRAINLIEST!!!!!!!!!!
    9·1 answer
  • What muscles are not under voluntary control?
    5·1 answer
  • number these in order: 1 rise of angiosperms 2. 2 rise of gymnosperms 3. 3 rise of bryophytes 4. 4 rise of chemoautotrophs and p
    15·1 answer
  • A flat area on a mountain is known as ?
    13·1 answer
  • Where is the chromatin located?
    8·1 answer
  • What are two ways that prokaryotes provide nutrients to humans
    7·1 answer
  • ___ can be defined as the process by which a living organism assimilates food and uses it for growth and for replacement of tiss
    11·1 answer
  • Which energy sources are limited because they can only be found or gathered in certain locations
    9·1 answer
  • On which of these issues is public opinion less likely to affect policymaking?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!