1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ElenaW [278]
2 years ago
10

.

Biology
2 answers:
Paha777 [63]2 years ago
6 0

Answer:

Nucleotides

Explanation:

Nucleotides are the basic building blocks of DNA.

Elan Coil [88]2 years ago
5 0

Answer:nucleotides

Explanation:

You might be interested in
Liquids have _____.
Mashutka [201]

variable shapes and variable volumes

8 0
3 years ago
Which statement is the BEST definition of an atom? A) Anything that has mass and occupies space. B) The smallest particle that h
Kitty [74]
It is defiantly not A, neither B, I'm thinking either C or D but I think it's C
6 0
3 years ago
Read 2 more answers
I do not understand because I was not in class. Can you please help me answer these questions.
g100num [7]
1. bony fish
2. cartilaginous fish 
3. jawless fish 
4. cartilaginous fish 
5. bony fish 
6. cartilaginous fish 
7. Jawless fish 
8. bony fish
9. cartilaginous fish 
10. bony fish

8 0
3 years ago
Which of the following is a physical change? A newspaper burns when placed in a fire. An iron chair rusts when left outside. A s
allsm [11]
A because a physical change , changes the appearance. the multiple choice question is A. 
7 0
3 years ago
Read 2 more answers
On the graph to the right, indicate which curve corresponds to each type of chlorophyll. Which curve corresponds to chlorophyll
vladimir1956 [14]

Answer:

First question - Green curve

Second question - Red curve

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • The process of DNA replication is biologically significant because it allows the cells of living organisms to A. convert solar e
    12·2 answers
  • Population growth how is population growth naturally regulated answer key
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • You pull out of the school parking lot and almost enter the road in front of an oncoming truck. For the next several minutes, yo
    9·2 answers
  • 7. ) Most of a cell's growth and activity occurs in the ______ phase.
    12·1 answer
  • What will cause water to enter a cell
    12·1 answer
  • What happens when an electrical gradient and a chemical gradient are applying opposite forces to active transport?
    12·1 answer
  • Hurry due in 5 min plz help for test
    11·2 answers
  • What techniques do you think Shubin and his fellow researchers used to determine how deep they should dig to look for Tiktaalik?
    9·1 answer
  • Free 10<br>Have a good day <br>:^D
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!