1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Citrus2011 [14]
3 years ago
5

Does anyone knows the answer of this question??

Biology
1 answer:
Vesnalui [34]3 years ago
4 0

Answer:

Option B

Explanation:

Conservation does not make coal a renewable resource (infinite resource) as there are still limited years before the supply runs out, nor does it make coal a  sustainable resource, which is not mentioned in the data. Conservation of coal is not correlated to the growth of the population in this diagram hence the only possible answer is option B. Option B is supported by the data in the diagram as seen by how increased number of conservation tatics increased the years before coal runs out for the average population growth rate.

You might be interested in
Can somebody help me please ??
Slav-nsk [51]
Everyone has different options on books they fancy, while some may like “Ages if innocence” others may not, but what makes a story timeless is the natural dramatics
5 0
2 years ago
6. Converging plates can form mountains, volcanic eruptions, earthquakes, tsunamis, and islands.
vfiekz [6]
Isn’t the answer to C when one goes over the top of another?
5 0
3 years ago
How does the Griffith experiment connect to the Meselson & Stahl experiment? How does this experiment support Meselson &
Nataliya [291]

Answer:

CHALLENGE ACCEPTED!!

Explanation:

THE GRIFFITH EXPERIMENT demonstrated that something in the virulent s strain of pneumococcus could transform non virulent r strain bacteria into a lethal form, even when the s strain bacteria had been killed by the high temperature.

So the two experiments aim at determining the replication mechanism.

4 0
3 years ago
When energy is transferred to or from a substance, it can change the molecules’ freedom of movement. True or False?
Jet001 [13]

Answer:

True

Explanation:

When transfer energy, the substance's temperature changes which can change the molecules' freedom. For example, when water freezes the water molecules loose temperature and slow down, unlike in a gas where molecules are free and energetic.

6 0
3 years ago
.Soil and plants are not considered nitrogen reservoirs true or false?
s344n2d4d5 [400]
False the answer is it is false
4 0
3 years ago
Read 2 more answers
Other questions:
  • Soils from different areas have unique characteristics based on the minerals, plant and animal matter they contain. A body has b
    7·2 answers
  • What is a substrate?
    11·1 answer
  • Which characteristic of water is most helpful to fish in a lake?
    13·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is a tumor? (1 point) o a mass of cells a stage in the cell cycle O a checkpoint in the cell cycle 0 a cell that results fr
    7·1 answer
  • Why are frogs absent on the galagos and other oceanic islands?
    6·1 answer
  • 100 points!! PLEASE ANSWER FAST!!
    7·2 answers
  • Valerie hypothesizes that frogs lay more eggs in warm water than in cold water. When Valerie designs her experiment, what should
    10·1 answer
  • In addition to observable traits, scientists use to classify living things
    9·1 answer
  • Guys how to make my hair tall and healthy
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!