1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xz_007 [3.2K]
3 years ago
15

PLEASE HELP!!!!! 

Biology
2 answers:
horrorfan [7]3 years ago
5 0
I think the answer would be D goodluck
Nimfa-mama [501]3 years ago
5 0
I took the test, It's D :)
You might be interested in
Plz help me answer this question!
Arte-miy333 [17]

Answer:

You will measure the rate of your pules and how fast its going.

You need to keep the thing you are doing for example( if your running you have to make the people run the same length as every one else.  

I hope this helps :)

Explanation:

3 0
3 years ago
Read 2 more answers
Compact, black, brittle coal is called _______.
Artist 52 [7]
That is Bituminous coal
3 0
3 years ago
How does clearcutting damage an area's ecological integrity?
PSYCHO15rus [73]
Clearcutting results in the removal of topsoil and some animal habits, which can prevent the forest from being able to grow again. While it is cheap, the damage to the food chain and surrounding ecosystem can destroy entire regions.
6 0
3 years ago
fatty acids are one of the products that result from the action of lipase in the digestive system what is one way that fatty aci
MatroZZZ [7]
<span>
They can be used as inflammation managers in the body. They are building blocks to make agents that increase and decrease inflammation in the body. </span>
7 0
3 years ago
Read 2 more answers
What is The special fluid that helps the bones
frez [133]

Answer:

Synovial fluid

Explanation:

This fluid is located in between your joints to help for the reduction of friction in moving joints. This liquid is thick, and also helps to prevent your bones from rubbing together. Think of it like a lubricant.

8 0
2 years ago
Other questions:
  • In order for the growth rate to remain constant what must happen to the birth rate?
    11·1 answer
  • A molecule is the smallest part of what?
    9·1 answer
  • Select the best answer for the question.
    8·1 answer
  • The best way to measure an exact volume is with a(n) _____________.
    14·2 answers
  • What Indian subcontinent is an accreted crustal block known as ___
    15·1 answer
  • Which tectonic plate boundary caused the structure that is circled in the image?
    14·1 answer
  • All are ways to combat water pollution except?? (A) regulation for water usage in urban areas (B) dumping oil down the drain (C)
    14·2 answers
  • Vascular tissue includes what other structures
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Takes ______ energy from the light independent reactions and __________ from the air to produce _________.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!