1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Len [333]
3 years ago
11

Which one of the following statements about secreted proteins is incorrect? Secreted proteins: are likely to have received N-lin

ked glycosylation in the rough ER. are synthesized on membrane-bound ribosomes, not free cytosolic ribosomes. that are constitutively expressed are exported as they are prepared, as opposed to being released as a response to a signal. cannot be exported into the extracellular space until the vesicle they are in fuses with the plasma membrane. travel directly from the rough endoplasmic reticulum into the trans face of the Golgi Apparatus.
Biology
1 answer:
Fiesta28 [93]3 years ago
4 0

Answer:

they travel directly from the rough endoplasmic reticulum into the trans face of the golgi apparatus

You might be interested in
What molecule is most favored by mitochondria and used by the body as quick energy?
Maru [420]

Cycle of urea or Ornithine Cycle

8 0
2 years ago
Read 2 more answers
Which of the four types of organic compunds serve as an energy source<br> WILL GIVE BRAINLIEST
mixer [17]

Answer:

Carbohydrates

Explanation:

5 0
2 years ago
Resources that renew themselves over time are
Alisiya [41]

Answer:

renewable resources. some examples are solar energy,trees, and fruits............................. love yall hope i helped pls give brainliest

8 0
3 years ago
Normally, only female cats have the tortoiseshell phenotype because _____
Ksivusya [100]
<span>The answer to this question would be: a male inherits only one allele of the X-linked gene controlling hair color

Tortoiseshell phenotype appears when a cat has two different X-linked gene that controls hair color. This result as a combination of hair color. Male cat sex gene is XY. Normally male cat only has 1 X gene, thus only have 1 color and can't have tortoiseshell phenotype unless there is pathological multiplication in X gene.</span>
5 0
3 years ago
The cell membrane performs several important functions in addition to separating the cytoplasm from the outside environment. It
lyudmila [28]

Answer:The cell membrane controls the movement of substances in and out of cells and organelles. In this way, it is selectively permeable to ions and organic molecules.

Explanation:

5 0
3 years ago
Other questions:
  • True or false? Selective legalization is an approach that would legalize those drugs of abuse that are the most likely to cause
    11·1 answer
  • Respiration is a process where many chemical bonds inside the body break and release energy. This energy is used to perform vari
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Identify traits that characterize all animals.
    10·1 answer
  • Which of the following best describe the information about the solar system
    9·1 answer
  • HELP IT IS DUE TODAY!!! i will mark you as the brainliest answer!!!!
    5·1 answer
  • Which best describes pitch?
    6·2 answers
  • 1. What did Mendel conclude about genes from parents to offspring?*
    6·2 answers
  • Describe the mechanism of blood sugar regulation (20 marks)​
    5·2 answers
  • The size changes in horses through time is an example of ______________________.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!