1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex
3 years ago
5

(GIVING BRAINLIEST!!!!!!!!!!!!!!!!!!!!!)

Biology
1 answer:
grandymaker [24]3 years ago
7 0

Answer:

A) Desert

Or

D) Tundra

Explanation:

Cold deserts (e.g Arctic, Antarctica) and tundras both recieve very little rainfall which can be in the form of snow, so it could be either one.

You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Describe the relationship between science and technology, and give an example of how they are related.
tankabanditka [31]
Science locates necessary info about how the universe works.  Engineering invents practical devices and systems using the knowledge learned by science. Technology is the collection of <span>products of engineering that can be used to solve problems and perform useful </span><span>tasks.</span>
5 0
3 years ago
Select ALL the correct answers. Based on these images, what can you say about the tentacles of an octopus and the limbs of a liz
slamgirl [31]

Tentacles of an octopus as well limbs of a lizard are analogous structures.

Analogous structures or organs perform the same function in different organisms that bear no resemblance to each other anatomically. Analogous structures are formed as a result of convergent evolution, i.e. different structures evolving for the similar function and thus having similarity. Tentacles of an octopus as well as limbs of a lizard are used for the similar function, i.e. locomotion in this case.

On the other hand, homologous structures result from divergent evolution. Homologous organs contain a similar basic structure but perform distinct functions in different organisms.

To learn more about Homologous organs here

brainly.com/question/14963404

#SPJ1

4 0
1 year ago
What happens in the ovlduct?<br> Implantation<br> Cleavage<br> Ovulation<br> Fertilization
Eduardwww [97]

Answer:

Hello! Your answer would be, D)Fertilization

Explanation:

Hope I helped! Ask me anything if you have any questions! Brainiest plz! Hope you make an 100% and have a wonderful day! -Amelia♥

4 0
3 years ago
Select the correct answer. which sentence describes an object that has kinetic energy? a. a seagull sits on top of a fence post.
ololo11 [35]

" a boat sails across the ocean" possess Kinetic energy. hence option d is correct.

<h3>What is Kinetic energy?</h3>
  • Chemical energy, thermal energy, electromagnetic radiation, gravitational energy, electric energy, elastic energy, nuclear energy, and rest energy are only a few of the many different types of energy that exist. Potential energy and kinetic energy are the two basic categories that can be used to group them.
  • An object's kinetic energy is what drives its motion. Kinetic energy can be converted into other types of energy and transported between objects.
  • The energy an object has as a result of motion is known as kinetic energy in physics. It is described as the effort required to move a mass-determined body from rest to the indicated velocity. The body holds onto the kinetic energy it acquired during its acceleration until its speed changes.

To learn more about Kinetic energy with the given link

brainly.com/question/12669551

#SPJ4

7 0
2 years ago
Other questions:
  • Plants that reproduce sexually and have flowers are called_____.
    11·2 answers
  • Is cellular respiration an endothermic or exothermic reaction and explain
    8·1 answer
  • Darwin believed in the idea that evolution happened slowly over a long period of time called what
    12·1 answer
  • Which of the following is an assumption of continuity theories?
    6·2 answers
  • 4. The Lion hunts down the Ox and kills it. What is this showing?
    7·2 answers
  • What is glucose combined with to make amino acid?
    15·1 answer
  • Crystalline
    5·1 answer
  • A rolling ball travels 7.3m in 3.7s. What was the velocity of the ball?
    6·1 answer
  • Which depth
    11·1 answer
  • PLEASE HELP ME WILL MARK BRAINLIEST LIKE GIVE ME THE REAL ANSWER
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!