1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lesya [120]
3 years ago
13

WILL MARK BRAINLIEST !!!

Biology
1 answer:
castortr0y [4]3 years ago
5 0

Answer:

If invansive species cause damage to the ecosystem, then they may cause environmental harm, economic harm, or impact human health.

Explanation:

I hope this helps

You might be interested in
A newly diagnosed lung cancer client asks how his tumor spread (metastasized) so fast without displaying many signs/symptoms. th
givi [52]

The nurse should explain the newly diagnosed lung cancer client that the reason why his tumor metastasized so fast without displaying many signs/symptoms is that: the malignant tumors affect area tissues by releasing enzymes and toxins that make the other normal cells to differentiate uncontrollably.

Metastasis is the property of spreading of cancer cells. When the tumor at a location in the body starts spreading top other locations as well, it is said to be metastasizing.

Malignant tumors are those that metastasize. They travel to near or distant locations at the body and start dividing. These are cancerous in nature.

To know more about malignant tumor, here

brainly.com/question/12020868

#SPJ4

6 0
1 year ago
Please this is for finals god blesss
Inessa [10]
This is parasitism because one organism (mosquito) is benefitting (by acquiring nutrition) and the other organism (human) is harmed (by the red itchy bump).
8 0
2 years ago
A huge molecule made up of many smaller molecules is called an?
Savatey [412]
Amino acids they are called. #YODARULES

7 0
3 years ago
At a location, rainwater runs off the face of a cliff that is 15 meters high. How is the face of the cliff most likely to change
natka813 [3]

The answer is;  Physical weathering by water would carve out the face of the cliff.


The bottom of the cliff would register the greatest weathering because of the force of the water hitting the rocks in the fall. As a cave is curved from the base of the cliff, the overhanging part of the cliff eventually collapses hence retracting the cliff a small distance upstream of the river. The diagram below demonstrates this;


3 0
4 years ago
Because of their small size, birds are very light eaters.<br><br> True<br> False
podryga [215]
THE answer is " true "
3 0
4 years ago
Other questions:
  • Which is made up of lipids?<br> steroids<br> peptides<br> prostaglandins
    11·1 answer
  • FAST PLEASE HELP ME
    13·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • In colorectal cancer, some tumor suppressor genes are inactive. This is an important factor resulting in uncontrolled cell divis
    14·1 answer
  • Facts about mollusks
    13·1 answer
  • Refer to the diagram to answer this question.
    6·1 answer
  • What happens to glucose inside a cell during cellular respiration
    5·1 answer
  • que cantidad de calor se debe aplicar a una barra de plata de 24kg para que eleve su temperatura de 20°C a 80°C​
    10·1 answer
  • Who is responsible for flooding and water scarcity
    15·1 answer
  • Need help asap please
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!