Atoms can have different numbers of which of the following electrons, protons neutrons or all of the above

1 answer:

7 0

Atoms may have different numbers of neutrons. Atoms are the smallest fraction of an element that can exist, and still show the properties of the element. They consists of electrons (negatively charged), protons (positively charged), and neutrons (no charge). The number of electrons is equivalent to the number of protons normally however an atom may loose or pick up electrons and have a positive charge or negative charge. The number of neutrons in the nucleus may vary within a given element to give varieties of atoms we call isotopes.

You might be interested in

Give an example of a living and non-living system

gogolik [260]

A non-living system would be a machine, such as an electrical system, air conditioning, etc. and a living system would be an animal, person, plant, etc.

7 0

2 years ago

9. If you could choose one ecosystem to spend the afternoon, would you choose the beach, the mountains, grasslands, or desert? W

OLEGan [10]

I would choose the mountain ecosystem.

The mountain ecosystem contains a complex living organisms. Mountain lands support a diverse array of habitats with large range of plants and animals. It is very crucial for biological diversity and is very wonderful to see. The climate is mostly cool which is fitting for relaxation.

3 0

3 years ago

Read 2 more answers

Please help me this is grade 7 work btw

Luden [163]

Don’t fall for the links love!

8 0

3 years ago

Which is a factor that could interrupt the progress of succession?

Sindrei [870]

The answer is
D. another natural disturbance

7 0

3 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago