1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tankabanditka [31]
3 years ago
5

How does depositon change the earths surface

Mathematics
1 answer:
jok3333 [9.3K]3 years ago
4 0

Step-by-step explanation:

"Deposition occurs when weathered rocks, soil, and sediments are carried by erosion to a new location and left there. Deposition happens when the forces carrying the sediments - wind, water, glaciers - are no longer strong enough to move the sediments. Rivers and streams fill with melting snow in the springtime."

You might be interested in
A line of roses forms the diagonal of a rectangular flower garden. Th e line of roses is 18.4 m long, and one side of the garden
professor190 [17]
Given that the garden is rectangular and a line of roses form the diagonal 18.4 m long, we required to calculate the length of the perpendicular side.
Here we shall use the Pythagorean theorem.
c²=a²+b²
where c is the hypotenuse, a and b are the legs.
from the information given:
c=18.4 m
a=13 m
plugging this into our expression we get:
18.4²=13²+b²
next we solve for the value of b
b²=18.4²-13²
b²=338.56-169
b²=169.56
b=√169.56
b=13.0215
hence the length to the nearest tenth of a meter will be approximately 13.0 m
6 0
3 years ago
What two numbers that can be added to -13 but also be multiply to 36
iragen [17]

Answer:

-9,-4

Step-by-step explanation:

8 0
3 years ago
Read 2 more answers
Consider the figure. What is the area of the figure, in square centimeters? ​
Serhud [2]

Answer: The

Step-by-step explanation: First we look at our right angles of the shape, Next you analyze your formula and use it to form your answer(formula: Base X Height).Then for the final step you would multiply 9x5=45.We wouldn't be doing all of them because that would be doing Total Area.

4 0
3 years ago
Read 2 more answers
M<2 64 and m<4 =2x-6
-Dominant- [34]

Answer:

5iejksjsjsjsnnsnsnsnsns

6 0
4 years ago
The top of a rectangular table has an area of 100 square feet and width of 5 feet. What is the length in feet of the surface
pochemuha
The answer to this is 20. You can find the length by using the formula l=a/w
4 0
4 years ago
Other questions:
  • A blimp is flying parallel to a road and is 2460 feet directly above it. The angles of depression of two parked
    14·1 answer
  • Katie’s water bottle contains 1 7/8 liters. She uses her bottle to fill sue’s. When she is done, her bottle contains 1/4 liter.
    12·1 answer
  • 3 hundreds, 17 tens, 3 ones, 1 tenths, and 2 hundredths. what number am I
    8·1 answer
  • 13. A discount retail store gives a 8% discount
    9·1 answer
  • Which values are solutions to the any quality below <br> check all that apply
    10·1 answer
  • What is the sum of 20 consecutive numbers, if the first one is m?
    14·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • If the mean of a normal distribution is 210, what is the median of the
    15·1 answer
  • 70. Dominic buys a new suit that is on sale for 20% off
    15·1 answer
  • PLEASE ASNWER MY LAST QUESTIONNNN!!!<br> Have a good day!!
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!