1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nalin [4]
3 years ago
8

Help pls // biology

Biology
2 answers:
motikmotik3 years ago
5 0
The answer is DNA replication
Maslowich3 years ago
5 0
I believe that is the answer DNA
You might be interested in
In the development of a cancer cell, the formation of new blood vessels is called
pantera1 [17]
In the development of a cancer cell, the formation of new blood vessels is called Angiogenesis, option B. When tumors are present in the body, circulation and the distribution of nutrients in the body is altered; thus, resulting in different kinds of disorders associated with cancer. With the presence of cancer, these tumors need more nutrients to spread and grow, which results in the formation of more blood vessels.
7 0
3 years ago
The longest part of the cell cycle where the cell continues normal functions, grows, and prepares to divide
dimulka [17.4K]
Interphase, the first part of the cell cycle
7 0
3 years ago
What is the function of cytoplasm ?​
vazorg [7]

Answer: The cytoplasm is responsible for holding the components of the cell and protects them from damage.

Explanation:

8 0
2 years ago
Read 2 more answers
What adaptations does the organisms have that makes it well suited for its environment
Sindrei [870]

Answer: Adaptations to environment are the means used by an organism to obtain food and energy in its particular habitat. Living things adapt themselves not only to their physical environment but also to their living environment, that is, they must adapt themselves to other plants and animals living around them.

Explanation:

7 0
3 years ago
An object has a weight of 21,532 N on Earth. What is the mass of the object?
Nuetrik [128]

7) 2,197 kg

The weight of an object on Earth is given by:

W=mg

where m is the mass of the object and g=9.8 m/s^2 is the acceleration due to gravity. Since we know the weight of the object, W=21,532 N, we can re-arrange the equation to calculate the object's mass:

m=\frac{W}{g}=\frac{21,532 N}{9.8 m/s^2}=2,197 kg


8) 2,197 kg

Mass is an intrinsec property of an object: it says "how much matter" is contained within an object. Therefore, the mass of an object does not depend on its location: so, the object has the same mass on Earth and on the moon, and so its mass is still the same as the previous exercise, 2,197 kg.


9) 187,500 N

The force exerted on an object is given by Newton's second law:

F=ma

where m is the mass of the object and a its acceleration. In this problem, m=250 kg and a=750 m/s^2, so the force exerted on the object is

F=(250 kg)(750 m/s^2)=187,500 N


10) 2nd Law

Newton's second law states that an object which is acted upon a force experiences an acceleration given by:

a=\frac{F}{m}

where F is the force and m the mass of the object. As a result, the object accelerates, so if it was at rest, it starts moving.

This is exactly what happens in this example: the ball is initially at rest, but then a force is applied on it (by the kick), so the ball is accelerated and it starts moving.

3 0
2 years ago
Read 2 more answers
Other questions:
  • Which describes a function of the pons? controls several autonomic body functions secretes many of the body's hormones controls
    13·1 answer
  • Which of these is a biotic factor? topography soil air bacteria
    14·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Which of the purely endocrine organs contain modified neurons that produce and secrete neurohormones?
    14·1 answer
  • Organisms can be classified in the same species by morphology and _____.
    15·2 answers
  • Which statement describes why the devshirme system was so important to
    13·1 answer
  • Disadvantages of internal fertilisation ​
    12·1 answer
  • A cell membrane is more flexible than a brick wall. Why might many cells benefit from a flexible cell membrane? and A building h
    7·1 answer
  • Which of the following best describes the difference between a plant cell and an animal cell?
    7·1 answer
  • What is the correct format for the scientific name of an extinct carnivorous dinosaur?.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!