1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scilla [17]
3 years ago
10

What is released at each level of a pyramid of energy

Biology
1 answer:
Finger [1]3 years ago
3 0
I think it is heat!!!!
You might be interested in
Explain the difference between the geocentric and heliocentric models of the solar system.
N76 [4]
Geocentric - Earth Centered solar system
Heliocentric - Sun Centered solar system
6 0
3 years ago
Read 2 more answers
Scientists can use mutants to study metabolic pathways. These organisms have a mutation in a gene encoding a metabolic pathway e
lisabon 2012 [21]

Answer:

Pyruvate kinase

Explanation:

Yeasts convert glycerol and sugars into glyceraldehyde 3-phosphate (G3P) through independent pathways. Then, G3P forms pyruvate and, in some circumstances, pyruvate is converted in ethanol, which can be used as energy sources. If the mutation affects any reaction before G3P formation, it will only affect yeast growing either on sugar or pyruvate but not both.

Pyruvate kinase is the only enzyme on the list acting after G3P is formed and before pyruvate is formed. All other options are enzymes acting only in the formation of G3P from sugars. Meaning that only pyruvate kinase mutants will lack the ability to grow on both sugars and glycerol.

6 0
3 years ago
The sole of a gecko's foot is covered with millions and millions of small, dry "hairs" that make direct contact with surfaces, a
tamaranim1 [39]

Answer: Van der Waals forces

Explanation:

Van der Waals forces are weak intermolecular forces that depend on the distance between two particles. They are caused by correlations in the change in polarization between two nearby particles. To put it in other words, when a particle changes its polarization (becomes more positive on one end and more negative on the other), so does the adjacent particle, and the next one, and so on. This causes these particles to stick together weakly.

The tiny "hairs" increase the surface area of the gecko's feet in contact with the wall, which makes the bond stronger and allows it to support all of its weight.

Because experiments have shown that geckos stick well to both hydrophobic and hydrophilic surfaces, we can assume there aren't any hydrogen bonds present.

Ionic bonds can't be present either because geckos wouldn't stick to electrically neutral surfaces, as these bonds require charged molecules.

6 0
3 years ago
Damage to the medial rectus muscles would probably affect ________.
algol [13]
The answer is A, convergence.
7 0
3 years ago
Read 2 more answers
When a person pulls a wagon, the person puts a force on the wagon that makes it move.
11111nata11111 [884]
So this my friend is a Contact Force. Anything that involves pushing, pulling, or creating friction is a contact force. So you will say it’s a contact force. Please Mark me brainliest
5 0
3 years ago
Other questions:
  • URGENT!!<br> please help me solve this i really don’t understand it
    14·1 answer
  • List three conditions under which a reptile might redirect blood away from its lungs
    6·1 answer
  • The process by which the information in a gene directs the synthesis of a protein is called ________.
    6·1 answer
  • What is a sample size
    8·2 answers
  • The activity of bacterial glutamine synthetase isI. inhibited by glutamineII. inhibited by adenylylationIII. activated by uridyl
    9·1 answer
  • Samuel is interested in taking a vitamin supplement. about what percentage of u.s. adults regularly take a vitamin-mineral suppl
    10·1 answer
  • Can someone answer number 10 I’ll put brainliest answers
    11·1 answer
  • hi can someone pls pls plsss! Help with this, I have a test and it’s due on Tuesday so I have time but for now can you pls help
    7·1 answer
  • What word describes the majority of permanent genetic mutations?
    11·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!