1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Wewaii [24]
3 years ago
7

Equation for cellular respiration?

Biology
2 answers:
gregori [183]3 years ago
8 0
C6H1206+6O2, 6CO2+6H2O+ATP
Ipatiy [6.2K]3 years ago
3 0
<span>C6 H12 O6 + 6 O2 --> 6 CO2 + 6 H2O</span>
You might be interested in
Vegetable farmers often plant soybeans every few years. Rotating crops breaks up the life cycles of many insect pests, and the s
Flauer [41]
The chemical food source for the soybean plants is A (Sunlight) because once the leaves emerge, it relies on sunlight to photothynsesize to get energy.
6 0
3 years ago
Read 2 more answers
Why does electrical energy have the least amount of waste?
UkoKoshka [18]

Answer:

they burn no fuel and release no greenhouse gases

Explanation:

4 0
2 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Select which types of nerves play the most
bulgar [2K]

Answer: sensory nerves

Explanation:got it right on edge

7 0
2 years ago
Darin wanted to make amino acids. He took the protein collagen and heated it to the point of denaturation at physiological pH. W
Svetllana [295]

Answer:

No, because he will not have broken covalent bond.

Explanation:

Denaturation  is the process adopted to affect or alter the chemical structure of a protein. This can be done or achieved by heat or addition of acid.

Denaturation can't break the peptide bond of the protein , this means that the , amino acid sequence is unaffected after the process.

Physiological pH is the pH Darin won't be able to have amino acid because the pH at which denaturation was being carried is basic, while the process requires acidic medium.

Collagen is a form of protein that can be found in the body.

8 0
2 years ago
Other questions:
  • You need to measure three things: 1. a quantity of water 2. the length of a leaf 3. the mass of a small stone Which unit of metr
    7·1 answer
  • como es posible que con solo 92 atomos distintosse pueda formar la gran variedad de materiales distintos que hay en el universo
    13·1 answer
  • The field of paleontology changed naturalist's views of biodiversity by showing?
    14·2 answers
  • What is a period with lower-than-average precipitation?
    14·1 answer
  • List three ways that spacesuits provide protection to astronauts.
    9·2 answers
  • During meiosis, sister chromatids are separated and move toward opposite ends of the cell as the centromeres that hold them sepa
    11·1 answer
  • Which of the following best describes what happens when the ATP synthase
    13·2 answers
  • Someone knows the answer and can help me
    14·2 answers
  • BLANK  can disrupt cellular homeostasis and can even lead to uncontrolled cell division and the formation of cancers. (And it is
    10·2 answers
  • Which foods would have the following nutrient test results?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!