1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
galben [10]
3 years ago
14

Describe what can happen to the 3-carbon molecules made in the Calvin Cycle.

Biology
1 answer:
gogolik [260]3 years ago
6 0

Answer:

Most of the three-carbon G3P is used to make more RuBP, keeping the Calvin cycle operating. ... ATP and NADPH, which are formed during the light reactions, are both used in the Calvin cycle.

Explanation:

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
A researcher isolates the blood of an individual who is sick. The blood is filtered through a porous material that will prevent
stich3 [128]

The answer would be A. a virus

The question states that the blood was filtered thru a porous material that prevented <u>all cells </u>from passing thru.

All of the options are cells except viruses.

Hope this helps:)

7 0
3 years ago
Read 2 more answers
SOMEONE PLEASE HELP ME WITH THIS I REALLY WANT TO PASS!!!!!!!!!!
Kay [80]
Its fossils or its nvm its definitely fossils
3 0
3 years ago
How does dispersal help different species? dispersal helps different species to increase their range of places, thereby helping
icang [17]

Dispersal helps different species to increase their range of places, thereby helping to increase their population size in different regions. Dispersal also helps to avoid crowding of diseases of a single location as species move to different locations.

<h3>What is dispersal?</h3>
  • Dispersal is the act of distributing things over a large area. It is when the individuals or seeds move from one site to their growing site.
  • Dispersal can be active (move by oneself) or passive (require dispersers).
  • Seed dispersal is the mechanism of transport of plant seeds to new sites for germination and the establishment of new individuals and colonies.
  • This depends upon the effectiveness of the seed dispersers.
  • Seed dispersal occurs by wind, water, animals, bats, explosions or gravity of the earth.
  • Dispersal of seeds is very important for the survival of plant species.
  • If the plants of same type grow too closely, they have to compete with each other for light, water and nutrients from the soil.
  • Seed dispersal allows plants to spread out from a wide area and avoid competing with one another for the same resources.

Learn more about dispersal here:

brainly.com/question/28039336

#SPJ4

4 0
1 year ago
What characteristic of water accounts for its properties of adhesion, cohesion, high specific heat, and nature as a solvent
KIM [24]
It has hydrogen bonds

7 0
3 years ago
Read 2 more answers
Other questions:
  • Production of oxygen during photosynthesis
    10·1 answer
  • Organize the following from largest to smallest: cell, tissue, nuclei, chromosomes, organs, genes, organ systems, organisms, DNA
    6·1 answer
  • Which of these is best described as being on the arm of a spiral?
    8·1 answer
  • Word-of-mouth influence comes to consumers from family, colleagues, and ________.
    5·2 answers
  • How is the white blood cell adapted to do its job
    15·1 answer
  • Regarding survival of organisms, it was hypothesized thata. the tallest organisms survive.
    8·1 answer
  • What triggers the development of a tornado?
    15·1 answer
  • Explain why leaves often contain starch.
    7·1 answer
  • Help need pls and thanks
    9·2 answers
  • Compare and contrast a ridge and a mountain.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!