The correct answer is D. species.
The definition of a species is termed as a group of interbreeding individuals cannot be easily applied to organisms that they reproduce only or mainly by asexual methods.
Species is termed as the basic unit of classification and taxonomic rank and also unit of biodiversity. It is the largest group of organisms whereby two individuals produce fertile offspring.
They are typically by sexual reproduction. Boundary which is between closely related species they becomes unclear.
Answer:
Warm oceans will be worse at absorbing CO2.
Explanation:
Hope this helps!
:)
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Sugar ...... (I need to make this 20 characters to submit)
