1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irga5000 [103]
3 years ago
10

What would most likely happen to plants if they did not have a waxy outer coating?.A. They would store more water in their leave

s.. B. They would photosynthesize at a faster rate.. C. They would store more sugars in their leaves.. D. They would be harmed by insects and UV radiation
Biology
2 answers:
Tomtit [17]3 years ago
5 0
I am pretty sure that  the thing which most likely happen to plants if they did not have a waxy outer coating is being revealed by the last option D. They would be harmed by insects and UV radiation. Every plant has to be protected by membrane so that it would be able to deal with drought small invaders and other external forces.
dsp733 years ago
4 0
 D. They would be harmed by insects and UV radiation
You might be interested in
How does pneumonia disrupt homeostasis?
zysi [14]
It disrupts homeostasis by putting our body in stress which isn’t good. It fills out alveoli with mucus and our bronchiole is inflamed with music. Besides, it shortens our breathe
7 0
3 years ago
Explain why it is important for dying cells to be properly removed
victus00 [196]
Cells within the body are properly arranged and their production uses up resources of the body. For example, red blood cells use iron while being produced. The body must dispose of cell properly to maintain the orderly arrangement of cells; for example, if dead skin cells were not removed, we would lose feeling in our skin due to the layer of dead cells. Moreover, the body must work to minimize wastage. This is why some of the iron from red blood cells is removed and reused.
6 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Please help me anything helps.
oksian1 [2.3K]

Answer: at the center of tectonic plates hope this helpsヾ(•ω•`)o

Explanation:

7 0
3 years ago
Read 2 more answers
Ribosome receive direction's from hereditary material to make certain.........
Rina8888 [55]

Answer: Proteins

Explanation:

The process where ribosomes use the mRNA to make proteins is called translation.

7 0
3 years ago
Other questions:
  • What the phenotype of a heterozygous offspring would look like if a color trait showed incomplete dominance
    10·1 answer
  • _____ is an unpleasant side effect that alcohol withdrawal creates for an alcoholic. excessive sleepiness leptokurtic reaction c
    9·1 answer
  • The tube leading from the bladder to the outside of the body is the:
    5·1 answer
  • A teenager with allergies is using oxymetazoline (afrin) nasal spray. what effect should the nurse evaluate the client for if mo
    7·1 answer
  • Molecule that contains the information for the growth and functioning of the cell
    14·1 answer
  • Put the levels of organization in order from smallest to largest; community, ecosystem, organism, biosphere, population
    6·1 answer
  • Please help thank you
    11·1 answer
  • Describe in detail the function of an umbilical cord
    13·1 answer
  • How many species of eukaryotes are there currently?
    13·1 answer
  • Examples of hypothesis ​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!