1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zepler [3.9K]
3 years ago
5

When animal cells are grown in a petri dish, they typically stop dividing once they have formed a single, unbroken layer on the

bottom of the dish. this arrest of division is an example of __________ mitosis s phase. density-dependent inhibition. lack of nutrients?
Biology
1 answer:
aleksandr82 [10.1K]3 years ago
3 0
This arrest of division is an example of Density-dependent inhibition. Density dependent inhibition is the process where crowded cells stop dividing; the number of cells in an area force competition for nutrients, space, and growth factors, therefore, when cells are crowded, they get signals to stop dividing. In density dependent inhibition, when density is high there is no cell division and when the density is low cells divide.
You might be interested in
Which of the following best describes ionic bonding? A. the transfer of valence electrons between atoms to make them neutral B.
ladessa [460]
A :)           the answer is a


7 0
3 years ago
What does the nucleus of the cell contain?
Alex777 [14]

Answer:

DNA

Explanation:

6 0
3 years ago
How does biodiversity contribute to the sustainability of an ecosystem?
Westkost [7]
It’s a simple thing really, the more options or “diversity” it’s more likely that it will be more sustainable and things will find a way to survive. Think about it like a video game level, the more tries you have the more likely you are for success
3 0
3 years ago
How are the lydias ice and lyric cycles different
Serjik [45]

Answer:

The lytic cycle involves the reproduction of viruses using a host cell to manufacture more viruses; the viruses then burst out of the cell. The lysogenic cycle involves the incorporation of the viral genome into the host cell genome, infecting it from within.

Explanation:

4 0
3 years ago
The overgrowth of algae poses a major problem for coral reefs. fish eat algae. why would intensive fishing contribute to the ove
pychu [463]
In the open ocean, especially around the surface, one of the main sources of food for fish would be the algae that grow at the surface & photosynthesize with the sun. Without fish to regulate the amount of surface algae, they overgrow and block the sun from the organisms on the coral reef.

Without sun, the reef is not able to sustain themselves & it's down hill from there.

I hope this helps!
8 0
3 years ago
Other questions:
  • What is a fiber like web in the cytoplasm that gives strength and support to the cell? Must be 12 letters and start with a C.#4
    8·1 answer
  • How is nitrogen obtained by animals?
    14·2 answers
  • How do mitosis and meiosis differ in the division of genetic composition?
    13·2 answers
  • You are scientists! You've been studying dna. You already know that part of the structure of DNA is 4 bases - adenine (A), guani
    6·1 answer
  • I need help !!
    11·1 answer
  • Comparative research into non-exercise activity thermogenesis (NEAT) concluded that _____. A. lean individuals who are overfed s
    8·2 answers
  • A. Crossing over decreases genetic diversity
    5·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • PSYCHOLOGY <br> Which statement is false
    5·1 answer
  • How does plant with particulate matter affect the economy
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!