1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
e-lub [12.9K]
3 years ago
13

Which functional characteristics of proteins distinguishes them from carbohydrates

Biology
1 answer:
forsale [732]3 years ago
8 0
Proteins are for growth and repair of cells  and are the basic components of lean tissue
You might be interested in
Which statement is not true about invertebrate animals?
Phoenix [80]

Answer:

e) Invertebrates lack a nervous system

Explanation:

One of the main characteristics of invertebrates is that they don't have a backbone. Backbones belong to the skeletal system. A totally different story is the nervous system which runs inside the backbone. Although the more complex nervous systems appear in vertebrates the simply fact of having eyes like crabs or insects implies having a nervous system that can control them.

4 0
3 years ago
State and explain the disadvantages of using chemicals to kill insects
zheka24 [161]
If you use chemicals to kill insects, you could risk getting the chemicals in unwanted areas. This could kill plants, animals, and other living things. You could also contaminate water if the chemicals get rinsed/drained into a water source.
5 0
2 years ago
What nucleotide is used during transcription instead of thymine
enyata [817]
It differs from DNA chemically in two respects: (1) the nucleotides in RNAare ribonucleotides—that is, they contain the sugar ribose (hence the name ribonucleic acid) rather than deoxyribose; (2) although, like DNA,RNA contains the bases adenine (A), guanine (G), and cytosine (C), it contains the base uracil (U) .
3 0
3 years ago
Which is the SI base unit of mass? A. liter B. meter C. kilogram D. pound
Tom [10]

A kilogram is the standard SI base unit of mass which is equivalent to 1000 grams and aproximately 2.2 pounds.


Hope it helped,


BioTeacher101

6 0
3 years ago
In an energy pyramid, the amount of energy at the producer level is 475,650 kilocalories. The pyramid has four trophic levels, i
Aliun [14]

Answer: There are three energy level in the energy pyramid. The producers have the 100% energy and the primary consumers feed on the producers and obtain 10% energy the producers have and secondary consumers feed on the primary consumers.

The energy left at this level is 10% of the energy that primary consumers have.

Hence, Producers will have 475,650 kilocalories

Primary consumers will have 475,65 kilocalories

Secondary consumers will have 4756.5 kilocalories

7 0
3 years ago
Read 2 more answers
Other questions:
  • People who have severed corpus callosum are likely to have difficulty: 1) writing a poem, because the speech area of their brain
    15·1 answer
  • If a 55-gallon drum represented all the water on Earth, how much water would be in the oceans?
    8·1 answer
  • Which of the following examples illustrates a pivot joint in use?
    12·1 answer
  • Kelp plants have been to grow up
    7·1 answer
  • 20 POINTS PLEASE HELP
    15·1 answer
  • What is the expected phenotypic ratio from a cross of heterozygotes (A1A2 x A1A2) for a phenotype that expresses incomplete domi
    11·1 answer
  • PLEASE HURRY !!!!!!
    11·2 answers
  • What are the important plants in agriscience?
    6·1 answer
  • What will most likely happen if a population is large and no migration, mutation, or environmental change occurs?
    15·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!