1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kotegsom [21]
3 years ago
10

between the first and second gene, and between the second and third gene.h+ one head (dom), h two heads (rec) e+ long ears (dom)

, e short ears (rec)c+ black (dom), c white (rec)Cross e+ h c+ X e h c 1000 offspringe h+ c e h c(Gene order is drawn arbitrarily, and is unknown)260 black, two-headed, long eared280 white, one-headed, short eared16 white, two-headed, long eared14 black, one-headed, short eared70 white, one-headed, long eared80 black, two-headed, short eared130 black, one-headed, long eared150 white, two-headed, short eared
Biology
1 answer:
marta [7]3 years ago
7 0

Answer:

The parents are of genotype heterozygous dominant and homozygous recessive. Supposing the dominant allele is N and the recessive allele is n, one of the parents will be Nn while the other nn. The phenotypic (based on visible characteristics) ratio will be 1:1 for dom/rec and rec/rec

Explanation:

You might be interested in
Why do scientists use comparisons between fossils and existing species to classify organisms?
frosja888 [35]

Answer:

Similarities among organisms lead scientists to relate organisms

Explanation:

Fossils found in sedimentary rock can be compared to one another and to living organisms to compare similarities and differences.

7 0
2 years ago
HElPPPpp ! I have to get this done before my picture day time-
Vesna [10]

Answer:

conseving is important so that future generations of wildlife will have a better life

cleaning up is important  because so that wildlife wont get traped in waste

chiming in is important because one perosn wont make a difference but as a group you can do more

Explanationste

7 0
3 years ago
Which of the following cells not have specialized tasks within the organism?
tamaranim1 [39]

Answer:a. prokaryotic. cellsExplanation:

6 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
15. During a routine cleaning of the incubators in a college laboratory, a student accidentally increased the tempe
diamong [38]

To test his hypothesis, the student will have to design an experiment to measure the effects of <u>temperature on cellular growth</u>.

To test the effects of temperature on cellular growth the student will have to create an experiment containing the there kinds of variables:

  • Dependent
  • Independent
  • Control

In this experiment, the control variable will be the kind of cells used, as well as the incubation methods being used. We identify these as the control variable given that they will remain constant.

The independent variable will be the Temperature at which we will place each cell being studied. The dependent variable, on the other hand, is by definition, what we seek to measure. In the case given it would correspond to the amount of cellular growth.

To test his theory of the effects of temperature on cellular growth, a student can design an experiment in which the control variable will be the cells themselves, the independent variable will be the Temperature, and the cellular growth can act as the dependent variable.

To learn more:

brainly.com/question/9199868?referrer=searchResults

5 0
2 years ago
Other questions:
  • Amino acids are the building blocks of which class of macromolecules?
    7·1 answer
  • What is the diferent between diffusion and facilitaed diffusion
    8·2 answers
  • All cells have____? Select all that apply
    11·1 answer
  • Mr. r married a healthy woman in his home country of italy and had three children, a boy with beta-thalassemia minor and two hea
    8·1 answer
  • PLZ HELP WILL GINE BRAINLIST :(
    12·1 answer
  • Which type of RNA brings the information in the genetic code from the nucleus to other parts of the cell?
    5·1 answer
  • Are cells an evolution​
    7·1 answer
  • The inferior region of the brain stem, the __________ houses many vital autonomic centers involved in the control of heart rate,
    7·1 answer
  • Please helpp if you dont know the answer that's ok but please helpp​
    10·1 answer
  • PLS HELP! i will give brainliest
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!