1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
3 years ago
10

Which metal has the lowest atomic weight of those listed here?

Biology
1 answer:
prohojiy [21]3 years ago
8 0
A. Titanium. Titanium's atomic weight is 47.867 
You might be interested in
Single celled organisms are able to maintain internal stability because they
Semmy [17]
Contain structures that regulate and perform life functions.
6 0
3 years ago
How do different biomes increase earth's biodiversity?
galben [10]

Answer:

Since Biodiversity means variety of living species on earth, different biomes provide habitats for those species. If there was no biomes then they would be no biodiversity. So the impact of biomes provide a living nature for those animals.

Explanation:

I don’t know what I just said lol. I’m dum so don’t like write everything I said. Change it up a little bit

6 0
3 years ago
Students are investigating the distribution of dandelions using quadrats.
Drupady [299]

Students are investigating the distribution of dandelions using quadrats. The students could during their investigation is they can do the pH test and the effect if it is happening or not.

<h3>What is pH?</h3>

pH is the measurement of the acidity or alkalinity of a substance. PH is a scale that marks from 0 to 12. The substance above 7 is acidic and the substance that is basic comes after 7. 7 is the number for neutral, which is pure water. The pH test is very easy to conduct.

To be sure that pH of the soil will not affect the distribution of dandelions. They first test the pH of the soil.

To learn more about  pH, refer to the link:

brainly.com/question/1979364

#SPJ1

8 0
1 year ago
Which would most likely result in low oxygen levels in the blood?
Ainat [17]

Answer:

yea it should be B

Explanation:

because the problems and or deformity in the blood cell prevents blood from carrying oxygen properly

7 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Inspiratory capacity is ________. A. functional residual capacity B. air inspired after a tidal inhalation C. the total amount o
    11·1 answer
  • During photosynthesis, plant cells take in water (H2O) and carbon dioxide (CO2) and release oxygen (O2). How is this different f
    6·2 answers
  • This is a trait that can be seen in an individual
    6·1 answer
  • Order from longest to shortest
    5·1 answer
  • When acid comes into contact with calcite, the acid bubbles. How can geologists use acid to confirm that the rock towers are mad
    6·1 answer
  • Need help asap please and thank you
    6·1 answer
  • There is a scammer/hacker on brainly that is posting "answers" saying that is on an link, (xtiny.cf/H5ct), don't believe him, th
    12·2 answers
  • Peanut plants have 40 chromosomes. How many CHROMATIDS will there be when meiosis begins? *
    7·1 answer
  • De que estan hechas las rocas<br>​
    10·1 answer
  • You are working on research involving competition between animals. Which of the following resources do you not need to measure?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!