1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
almond37 [142]
2 years ago
10

What most likely caused the rabbit population to decrease over the first time unit shown in the following graph? a. A disease in

the rabbit population b. A decrease in amount of healthy grass available c. An decreasing population of hawks d. A higher-than-ideal population of snakes Please select the best answer from the choices provided A B C D
Biology
2 answers:
skelet666 [1.2K]2 years ago
7 0

It’s either A or B

Diseases can often cause a decrease in the population

But also without healthy grass for them to eat, they begins to die off cause of not a lot of food left for them to eat enough to survive.

Illusion [34]2 years ago
7 0
It’s most likely to be D
You might be interested in
At 88 meters (289 feet), Landscape Arch is the longest natural arch in Arches National Park in Utah. Many geologists believe it
kirill115 [55]
<h2><u>Answer:</u></h2>

The recreation center is adjoining the Colorado River, 4 miles (6 km) north of Moab, Utah. In excess of 2,000 common sandstone curves are situated in the recreation center, including the notable Delicate Arch, just as an assortment of one of a kind land assets and developments.

A characteristic curve, regular scaffold, or (less usually) shake curve is a characteristic shake development where a curve has framed with an opening underneath. Regular curves ordinarily shape where inland bluffs, waterfront precipices, blades or stacks are liable to disintegration from the ocean, streams or enduring (subaerial forms).

4 0
3 years ago
Read 2 more answers
The energy content of food is described in terms of calories because
Diano4ka-milaya [45]
The energy content of food is described in terms of calories because the energy in food ultimately becomes heat.

God bless!
8 0
3 years ago
Which of these plant hormones is not typically considered a growth-promoting substance?
kompoz [17]
The answer is: Abscisic acid. 
6 0
2 years ago
Sea turtles dig holes on coastal
Diano4ka-milaya [45]

Answer:

the question is not finished amigo

7 0
3 years ago
Read 2 more answers
How is a yeast cell different from an onion skin cell?
solmaris [256]
Yeast lacks a membrane-bound nucleus. The onion skin cell has one
6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • During a standing pulling assessment, a client compensates by moving his head forward. Which of the following static stretches w
    8·1 answer
  • A 63-year-old woman has been diagnosed with polycythemia vera (pv) after undergoing a series of diagnostic tests. when the woman
    7·1 answer
  • Another name for a warm blooded animal is
    12·2 answers
  • Gametophytes have gamete-producing organs called _____.
    8·1 answer
  • Based on what you learned in Virtual Lab on hypertension which of the following combinations will likely lead to hypertension
    12·1 answer
  • In a community, before biomass is widely used as an energy source, several experts, including an ecologist,are hired to provide
    8·1 answer
  • Communities only contain one population of organisms. True or False ?
    9·1 answer
  • Help me with this question
    14·2 answers
  • What were the independent, dependent, and control variables in your investigation? Describe the variables for the simulation wit
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!