Body cells are those that are responsible for the formation of tissues and organs, while a gamete is that cell responsible for reproduction.
- Gametes are sex cells, when a male gamete joins a female gamete in the framework of sexual reproduction of plants and animals, a zygote is formed.
- Body cells are any cell in the body that are not gametes, which originate from embryonic stem cells and constitute the totality of the body's tissues and organs of multicellular organisms.
Therefore, we can conclude that body cells are those cells responsible for the growth of organs and tissues and gametes are each of the sex cells that fuse during fertilization.
Learn more about the difference between body cells and gametes here: brainly.com/question/14892337
Answer:
Explanation:
The tubular or sheet-like cristae membranes are the main site of oxidative phosphorylation, harboring the complexes of the respiratory chain and the F1Fo-ATP synthase [5], [6], [7], [8], [9]. Fig. 1. Mitochondrial contact site and cristae organizing system (MICOS) in yeast.
Answer:
As a cell grows, its surface area-to-volume ratio decreases
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved