1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilya [14]
3 years ago
7

What effect would there be on the final daughter cell if the spindle fibers failed to pull a chromosome toward the pole, as in c

ase of non-Disjunction?
Biology
1 answer:
AleksAgata [21]3 years ago
5 0

Answer and Explanation:

Nondisjunction occurs when homologous chromosomes fail to segregate during anaphase I or sister chromatids fail to segregate during anaphase II. The result is an addition or loss of one or more chromosomes. Nondisjunction is associated with disorders like Down's syndrome due to an extra chromosome, Klinefelter's syndrome or Turner's syndrome. These phenomenon where one has three members of homologous chromosome is called trisomy.

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Who can help me with the question
Softa [21]

Answer:

c

Explanation:

z

6 0
2 years ago
What holds the two strands of DNA molecules to each other
Nadya [2.5K]
What holds the two strands of DNA molecules to each other. Hydrogen Bonds
7 0
3 years ago
Read 2 more answers
பட்ட
monitta

Answer:

Gametes

Explanation:

Gametes consist of sperm cells and egg cells...

8 0
3 years ago
What happens to the atomic radius as you move down a group on the periodic table
ipn [44]
As you move down a group, atomic radius increases
3 0
3 years ago
Other questions:
  • What types of organisms produce food from inorganic molecules(very few) or sunlight (lots)?
    13·1 answer
  • What are the main components common to all viruses
    10·1 answer
  • Which statement accurately describes this population of alligators in Florida?
    8·1 answer
  • Short note about autocrine
    8·1 answer
  • During which of these stages of meiosis do homologous chromosomes form tetrads?
    14·1 answer
  • 1. If the beetle population moves into a new environment with dark soil and vegetation, what
    9·1 answer
  • When is it appropriate to use a line graph, bar graph and a pie chart?
    13·1 answer
  • Which description is a characteristic of r-selection strategy? A. most offspring reach adulthood B. reaches reproductive capabil
    11·1 answer
  • Which factors affect the solubility or dissolving rate of a substance?
    12·2 answers
  • WILL GIVE BRAINLIEST!!! In which parts of the cell cycle would chromosomes be paired up? Check all that apply. interphase metaph
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!