1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilya [14]
2 years ago
7

What effect would there be on the final daughter cell if the spindle fibers failed to pull a chromosome toward the pole, as in c

ase of non-Disjunction?
Biology
1 answer:
AleksAgata [21]2 years ago
5 0

Answer and Explanation:

Nondisjunction occurs when homologous chromosomes fail to segregate during anaphase I or sister chromatids fail to segregate during anaphase II. The result is an addition or loss of one or more chromosomes. Nondisjunction is associated with disorders like Down's syndrome due to an extra chromosome, Klinefelter's syndrome or Turner's syndrome. These phenomenon where one has three members of homologous chromosome is called trisomy.

You might be interested in
Is the vascular system in plants an actual organ system?
katen-ka-za [31]

Answer:

       

Explanation:

6 0
3 years ago
Read 2 more answers
Whats the difference between body cells and gametes
sergey [27]

Body cells are those that are responsible for the formation of tissues and organs, while a gamete is that cell responsible for reproduction.

  • Gametes are sex cells, when a male gamete joins a female gamete in the framework of sexual reproduction of plants and animals, a zygote is formed.

  • Body cells are any cell in the body that are not gametes, which originate from embryonic stem cells and constitute the totality of the body's tissues and organs of multicellular organisms.

Therefore, we can conclude that body cells are those cells responsible for the growth of organs and tissues and gametes are each of the sex cells that fuse during fertilization.

Learn more about the difference between body cells and gametes here: brainly.com/question/14892337

4 0
2 years ago
In mitochondria cristae act as sites for what​
nikitadnepr [17]

Answer:

Explanation:

The tubular or sheet-like cristae membranes are the main site of oxidative phosphorylation, harboring the complexes of the respiratory chain and the F1Fo-ATP synthase [5], [6], [7], [8], [9]. Fig. 1. Mitochondrial contact site and cristae organizing system (MICOS) in yeast.

4 0
2 years ago
What changes occur to the ratio of surface area to volume as a cell<br> grows?
seraphim [82]

Answer:

As a cell grows, its surface area-to-volume ratio decreases

4 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Other questions:
  • What type of wave is sound????????????????? help
    10·1 answer
  • Which of the neurons is a touch receptor known as a merkel disc?
    9·1 answer
  • Which best describes adaptive radiation?
    12·1 answer
  • What happens when a lithium ion is attracted to a floride ion?
    7·1 answer
  • When cells perform photosynthesis, they transform energy from one form to another. Which of the following takes place during pho
    6·2 answers
  • A plant tropism involves the responses. This response is always the result of—
    11·1 answer
  • GAANO AKO KAGANDA BASE ON YOUR BATTERY PERCENTAGE​
    9·2 answers
  • What is the purpose of protein synthesis?
    12·1 answer
  • A cluster of cases of legionellosis have occurred in your neighborhood. People with the illness have cough, fever, shortness of
    8·1 answer
  • Why did short plants reappear in mendel’s F2 generation?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!