1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sp2606 [1]
3 years ago
9

Suppose that in​ 2008, 819,450 citizens died of a certain disease. Assuming the population of the country is 250 ​million, what

was the mortality rate in units of deaths per​ 100,000 people?
Biology
1 answer:
Goshia [24]3 years ago
8 0

Answer:

The correct answer is 327.78.

Explanation:

A mortality rate refers to the determination of the rate of the occurrences of deaths in a given population in the course of a particular time period. The formula for finding the mortality rate is:  

Deaths taking place in a given time duration / the size of the populace among which the deaths have taken place × 10ⁿ

The given population of the country is 250 million

The number of individuals died due to a certain disease is 819450

Thus, the mortality rate per 100000 can be calculated as:  

819450 / 250000000 × 100000 = 327.78 deaths per 100,000 people.  

You might be interested in
What was a conclusion that Mendel drew from the F2 generation of this cross?
Ber [7]
<h3><u>Answer;</u></h3>

That parental traits that were not observed in the F1 reappeared in the F2.

<h3><u>Explanation</u>;</h3>
  • Mendel accounted for the observation that traits which had disappeared in the F1 generation reappeared in the F2 generation by proposing that traits can be dominant or recessive, and the recessive traits were obscured by the dominant ones in the F1.
  • <em>I</em><u><em>t was important that Mendel examined not just the F1 generation in his breeding experiments, but the F2 generation as well, because parental traits that were not observed in the F1 reappeared in the F2.</em></u>
3 0
3 years ago
What is likely to happen if a new organism that feeds off mice is introduced?
n200080 [17]
<span>There is a possibility that the population of mice will go way down or even become extinct.</span>
4 0
3 years ago
Which of the following procedures would most likely maximize destructive forces?
katen-ka-za [31]

Answer:

increase the speed of running water

Explanation:

hope it was right

4 0
3 years ago
Read 2 more answers
Which answer choice correctly identifies the diagrams above?
kvv77 [185]

Answer:

umm i really want to help u with this question but where is the diagram?

Explanation:

5 0
3 years ago
Read 2 more answers
What is the biology behind the improvement of strength in the human body? describe
Naily [24]

Answer:

Due to its function to fight against disease.

Explanation:

Improvement of strength in the human body is very important because strong body helps in fighting against diseases. Strong body helps in doing physical activities and also helps in protecting itself from every type of harm. Weak human body can't fight against diseases due to weak immune system so we can conclude that improvement in human body is necessary for survival, development and health of human.

6 0
3 years ago
Other questions:
  • The 2 major components of the cell membrane are ______ and _______
    12·1 answer
  • A variety of different mechanisms in nature help create diversity in organism populations. The tundra found in the northernmost
    7·2 answers
  • What important nutrient in water is produced from photosynthesis​
    5·1 answer
  • How does human evolution or natural selection relate to the susceptibility of disease?
    8·2 answers
  • The build up of hard waste deposits within the kidneys are called kidney ______.
    5·1 answer
  • How do dendrites help the function of nerve cells? (1 point) A. They help the neuron receive messages from the dendrites of anot
    9·1 answer
  • WILL GIVE BRAINLIEST!!!!!
    7·2 answers
  • Need help, asap please
    15·1 answer
  • A boring is a tunnel made by:<br><br> protozoa<br> mollusks<br> insects<br> worms
    8·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!