1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rasek [7]
3 years ago
11

Based on the information provided. In which domain would the organism be classified?

Biology
2 answers:
erma4kov [3.2K]3 years ago
8 0
It’s B there answer is B
Kruka [31]3 years ago
7 0

Answer:

Archaea

Explanation:

Archaea Bacteria are the only bacteria that can adapt in crazy and impossible environments, Such as an underwater Volcano

You might be interested in
New membrane phospholipids are synthesized by enzymes bound to the _____________ side of the _________________ membrane. a. lumi
JulsSmile [24]

Answer:

The correct option is C) cytosolic, endoplasmic reticulum

<em>New membrane phospholipids are synthesized by enzymes bound to the cytosolic side of the endoplasmic reticulum membrane.  </em>

Explanation:

Synthesis of proteins that are destined to membrane or exportation starts in the cytoplasm with the production of a molecule portion known as a signal aminoacidic sequence. This signal sequence is located in the amino extreme of the synthesizing protein, and when it reaches a certain length, it meets the signal recognizing particle. This particle joins the signal sequence of the protein and leads the synthesizing protein and associated ribosome to a specific region in the Rough endoplasmic reticulum where it continues the protein building. When they reach the membrane of the endoplasmic reticulum, the signal recognizing particle links to a receptor associated with a pore. Meanwhile, the ribosome keeps synthesizing the protein, and the enlarged polypeptide chain goes forward the reticulum lumen through the pore. While this is happening, another enzyme cuts the signal sequence, an action that requires energy from the ATP hydrolysis. When the new protein synthesis is complete, the polypeptide is released into the reticulum lumen. Here it also happens the protein folding (which is possible by the formation of disulfide bridges of proteins are formed) and the initial stages of glycosylation (the oligosaccharide addition).  The newly synthesized proteins get packaged into vesicles that take them to the Golgi apparatus.

In the Golgi complex, proteins suffer their final association with carbohydrates and lipids to originate glycoproteins and glycolipids. Once these processes are done, the glycoproteins and glycolipids are packaged again into new vesicles that drive them to their final destiny.

3 0
3 years ago
The chemicals released in a synapse when a signal passes through are _________. The chemicals released in a synapse when a signa
rodikova [14]

Answer:

Neurotransmitters

Explanation:

Examples of neurotransmitter are acetylcholine, epinephrine, dopamine, GABA, serotonin, and etcetera. They are released from synaptic vesicles in the presynaptic membrane. They then diffuse through the synaptic cleft or neuromuscular junctions and bind to their receptors on the postsynaptic membrane and invoke an impulse.  

7 0
3 years ago
Why do planets and the moon shine so brightly if they do not produce light
Sophie [7]
The moon reflects light from the Sun, and the sun shines on the planets :)
3 0
3 years ago
Read 2 more answers
Jackrabbits living in the desert have large ears that help release body heat. Large ears are an adaptation to which is limiting
Cloud [144]

Answer:

It is the adaptation to the limiting factor temperature.

Explanation:

The presence of long ears is the most astonishing characteristic of jackrabbits. These long ears are the jackrabbits' adaptation to their native desert habitat, which helps them to cool down the temperature of their body. The ears allowed them to do so as they are thin and possess an extensive mass of blood vessels. When the temperature of the desert becomes hard to hands, the long ears of jackrabbits allow them to enhance the flow of blood via the ears by dilating its blood vessels. This dilation helps to deflect heat from the body and thus cools the creature.

4 0
3 years ago
What is most likely the cause of the differences in birds in the picture
wlad13 [49]

Answer:

Explanation:

send the picture then I will answer

4 0
4 years ago
Other questions:
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • What's the scientific name for an ostrich? I know the answer just want to see if you do.
    15·2 answers
  • please help me! Which of these is responsible for ridding the body of waste? A) nervous system Eliminate B) excretory system C)
    13·2 answers
  • Which amino acids have side chains that fit into the specificity pocket of chymotrypsin? arginine glycine tyrosine aspartate phe
    7·1 answer
  • Briefly explain the process of cloning an animal
    10·1 answer
  • Explain how cancer relates to the cell cycle and give an example.
    6·1 answer
  • Select all of the reasons that a multicellular organism's cells undergo mitosis. question 33 options: to regenerate and repair t
    5·1 answer
  • Using a Punnett Square give the genotype and the phenotype for the following cross:
    14·1 answer
  • In which cells dose meiosis occur?
    11·2 answers
  • A B C OR D?.........​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!