1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hoochie [10]
3 years ago
7

How many cells are our body made of ? ♡

Biology
2 answers:
Tanya [424]3 years ago
4 0

our body contains trillion of cells that we just cant count cuz theres so many

Mars2501 [29]3 years ago
3 0
Thier are 37.2 trillion
..
You might be interested in
What is the visual acuity of the average human eye?
zavuch27 [327]

Answer:

20 20 vision

Explanation:

msgic

6 0
2 years ago
Organisms in an ecosystem are interdependent. Do you think humans have interdependent relationships with other organisms? Explai
faust18 [17]

Answer:Organisms rely on each other to sustain the ecological environment, something that humans have been lacking in. So, in general, organisms are interdependent because they have no choice. There are more particular instances (mutualism, symbiosis, etc.) where the connection is more local and direct.

Explanation:

:D

8 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
The fluid surrounding the organelles of a cell is the —
mario62 [17]

Answer:

cytoplasm

Explanation:

8 0
3 years ago
DNA replication is the process by which DNA is copied during the cell cycle. True or False.
seraphim [82]
The statement is true. DNA replication process happen during the cell cycle.
5 0
3 years ago
Other questions:
  • The study that uses microscopes to see the minute details of organ parts is called
    7·2 answers
  • The joint comsec monitoring activity provides opsec assistance by:
    14·1 answer
  • Describe how elements joining together to form chemical compounds is similar to the way the letters on a computer keyboard join
    15·1 answer
  • Help!!!!!!!!!!!!!!!!!!!!!!!!!
    8·1 answer
  • The statement 2 + 2 = 4 would be considered a _____ in the science world
    14·1 answer
  • Is diffusion the only way materials can enter the cell?
    14·1 answer
  • Reset
    9·1 answer
  • Cloning ____?
    11·1 answer
  • Please answer I will give u brainliest
    13·1 answer
  • C6H12O6 + O2 --&gt; CO2 + H2O + ATP
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!