1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
crimeas [40]
3 years ago
12

Why did dna technology lead to more use of cladistics?a. it showed that the linnaean system was the most accurate.b. it changed

ideas about which animals were closely related.c. it proved that eukaryotes formed from endosymbiosis.d. it showed that there are three domains and six kingdoms?
Biology
2 answers:
Alexandra [31]3 years ago
8 0
The correct option from given options is "b", that is <span> it changed ideas about which animals were closely related.
</span>Cladistics<span> was </span>invented for the purpose of improving on taxonomy and it is a way to deal with biological classification. DNA technology lead to more use of cladistics because it changed ideas about which animals were closely related and also it showed new evolutionary relationships between animals.
aleksandr82 [10.1K]3 years ago
4 0

Answer:

b

Explanation:

You might be interested in
How do dolphins adapt to their habitat
zubka84 [21]
They have to adapt to the water, the animals in the ocean, the way they hear and see.

5 0
3 years ago
Question 13 (1 point) How much does hair grow on average in one month?
marshall27 [118]
I believe it’s A Explanation, On average, hair tends to grow between 0.5 and 1.7 centimeters per month. That is about 0.2 to 0.7 inches. And I’m really sorry if I’m wrong but hope I helped
4 0
3 years ago
Which type of basin forms at divergent boundaries?<br> Rift<br> strike-slip<br> wedge<br> arc
lesya692 [45]

Answer: rifts

Explanation:  

   

4 0
4 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Name the process:<br> binary,fission budding,vegetative propagation, regeneration
zlopas [31]

Answer:

Fission Budding

Explanation:

I hope this helps. I think it may be right.

7 0
2 years ago
Other questions:
  • If you were a doctor, and a lab technician told you that the results of a patient’s lab results were Gram-positive, what antibio
    6·1 answer
  • The cryosphere is part of which sphere of the Earth system? atmosphere biosphere geosphere hydrosphere
    11·2 answers
  • Is oxygen a reliable predictor in photosynthesis
    11·2 answers
  • Hallucinogens are a type of drug that causes distortion of the drivers______.
    7·1 answer
  • Why the atmosphere must be studied in order to study winds.
    13·1 answer
  • Which step happens first to a chromosome during cell division?
    6·1 answer
  • True of false Mendel realized that when he crossed two pea plants that were the offspring of a pea plant with yellow peas and a
    5·1 answer
  • Pls answer these questions​
    10·2 answers
  • What is the energy source which runs the electron transport chain?
    9·1 answer
  • What is not true about landslide
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!