1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Evgesh-ka [11]
4 years ago
6

What are the building block of marcromolecules

Biology
1 answer:
hichkok12 [17]4 years ago
6 0
All life is composed mainly of the four macromolecule building blocks: carbohydrates, lipids, proteins, and nucleic acids. The interactions of different polymers of these basic molecule types make up the majority of life's structure and function.
You might be interested in
Which common disease is not included in the suite of diseases of copd (chronic obstructive pulmonary disease)?
valina [46]
Check the attached file.

7 0
3 years ago
Please need help with this biology question (photo)
Morgarella [4.7K]

Answer:

Energy flows through the organisms from bottom to top and increases at each level.

Explanation:

6 0
3 years ago
The overriding problem with both theories of muscle growth, hypertrophy and hyperplasia, is that __________. A. neither can be a
zhannawk [14.2K]

Answer: A. neither can be accepted as correct because muscles growth is difficult to study in humans.

Explanation:

Hypertrophy can be defined as the increase in the fiber size of the muscle whereas the hyperplasia can be defined as the increase in the number of muscle fibers. Additionally the hypertrophy suggests that adding more proteins to the fibers is suggestive of the growth of the muscles. But these two theories cannot be directly related to the muscle growth in humans as the development and growth of muscles are dependent upon several factors like diet, any kind of disease which restrict the muscle growth and movement, physical activities, mineral availability responsible for growth, malnutrition, and others.

3 0
3 years ago
Read 2 more answers
Plant parts used for circulation?
coldgirl [10]

The three primary parts of the plant's vascular system are the xylem, phloem and cambium. Hope It Helps!


4 0
3 years ago
Which of the following is true about protein molecules?
iVinArrow [24]
<span>D. The shape and folded structure of a protein molecule are important in determining its function.</span>
8 0
4 years ago
Read 2 more answers
Other questions:
  • The client receives methotrexate (rheumatrex). the nurse assesses for side effects of this drug. which side effects are a primar
    10·1 answer
  • Which strain of feminism argues that there are biological differences between men and women and that these differences should be
    9·1 answer
  • For a particular species of wolf, 55% are female, 20% hunt in medium-sized packs, and 15% are both female and hunt in medium-siz
    5·1 answer
  • Major chemical components of a chromosome are ______________.
    12·1 answer
  • How many nucleotides are needed to specify three amino acids? (1 point)
    9·2 answers
  • A group of organisms of the same species that live in the same area at the same time is called ___
    5·2 answers
  • Which situation is a result of crossing-over during meiosis?
    7·1 answer
  • The major groups of animals that lived during the Late Paleozoic were the
    7·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • you are doing a biochemical analysis of molecules from cells from patients with a certain disease compared to cells from control
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!