Answer:
SS and ss
Explanation:
Smooth pea plants aee dorminant over wrinkle
The offspring will be genetically identical to the parent because vegetative reproduction is a form of asexual reproduction. Therefore, there is only one parent and the offspring is identical to the parent.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
<span>Yes, people besides athletes can benefit from skill-related fitness. Skill related fitness training can increase the coordination, reaction time, balance and agility of individuals at large, leading to an increased in ability to complete routine workplace tasks. Accident avoidance can be a benefit to cab drivers with increased reaction times. Wait staff can benefit from increased balance to skillfully carry large trays, Mechanics with good coordination are able to more quickly assemble complex components and in the even of a physical confrontation police officers can benefit from increased agility.</span>
Strain hope this helps you that's what I found
