The first person that answered is correct just to let you know!
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
<span>Out of the following given choices;</span>
A. Further antibody attack.
B. Phagocytosis
C. Helper T cells
D. B cells.
E. None of the above.
The answer
is B. Phagocytises is the engulfment of a particle from the external
environment, by a cell, for ingestion. This is especially critical for the
function of macrophages, which are immune cells. These macrophages have receptors
for the Fc region of the immunoglobulin on their cell membrane surface.
Answer:
Explanation:
The nucleus is surrounded by a membrane called the nuclear envelope, which protects the DNA and separates the nucleus from the rest of the cell.
1. gamete production
2. sperm transported near egg
3. fertilization
4. zygote forms