1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marshall27 [118]
3 years ago
11

A prokaryotic cell is being looked at under the microscope and a scientist is watching molecules such as sodium enter and exit t

he cell. What part of the prokaryotic cell is under the microscope?
Biology
1 answer:
kogti [31]3 years ago
7 0

Answer:

Cell membrane

Explanation:

In the cell membrane, there is the process of transport of substances, with energy expenditure, through the mediation by specific carrier proteins.

This usually occurs from the lowest to the highest concentration medium in the cell (against the concentration gradient). This process is called active transport.

Some examples of substances that can be actively transported across the membrane are: Iron, potassium, iron, hydrogen, calcium and sodium ions (as described in the question), as well as some types of amino acids and sugars.

You might be interested in
Blood is best classified as connective tissue because _____.
ddd [48]

Answer:

It is composed of extracellular matrix (ground substance) and cells

Explanation:

Connective tissue is defined as a type of tissue which binds other tissues and it is composed of a ground substance comprising of fibres into which tissue specific cells are scattered.

Blood has plasma as the ground substance in which blood cells (RBCs, WBCs, platelets are scattered)

Further, it also connects various parts of the body, i.e. acts as a medium for transport and signaling.

3 0
4 years ago
Which factors are responsible for high and low tides?
Vaselesa [24]
The following diagram shows how the moon causes tides on Earth: In this diagram, you can see that the moon's gravitational force pulls on water in the oceans so that there are "bulges" in the ocean on both sides of the planet. The moon pulls water toward it, and this causes the bulge toward the moon.
6 0
3 years ago
In our Photosynthesis Lab, we saw photosynthesis in action.
mixer [17]
Zcs. ;.I’m not here at I
8 0
3 years ago
Which lifestyle choices lead to good health? Check all that apply.
Neporo4naja [7]

Answer:

Yes, you are correct! C,D and E are correct

4 0
4 years ago
Read 2 more answers
NEED HELP ASAPPPP!!! PLEASEE
pentagon [3]

stop spamming please u will get help be relaxed and wait

3 0
3 years ago
Other questions:
  • Within a eukaryotic cell aerobic cellular respiration occurs within the
    8·2 answers
  • Ferns grow by:<br><br><br> photosynthesis<br><br> reproduction<br><br> mitosis
    10·1 answer
  • A fruit fly has black eyes. having red eyes is a dominant trait (r) and having black eyes is a recessive trait (r). which descri
    9·2 answers
  • What is parasympathetic nervous system
    12·1 answer
  • Sort the following in the correct sequence for the flow of energy in a food chain. Start with the first organism on bottom.
    9·1 answer
  • . Complete the below sentences using: catalyst, intolerance, lactose, chemical reaction, reused, lactase
    6·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • A student is given a tissue sample to examine under a microscope . Which of the following would be evidence that the tissue samp
    15·1 answer
  • Deonte’s family sees a solar panel display and considers using solar power for their home. Deonte knows that solar energy is a n
    14·2 answers
  • Explain why it would not be possible to accurately measure hemoglobin concentration if the RBCs were not first lysed
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!